Incidental Mutation 'R1455:Pramel7'
ID161702
Institutional Source Beutler Lab
Gene Symbol Pramel7
Ensembl Gene ENSMUSG00000025839
Gene Namepreferentially expressed antigen in melanoma like 7
Synonyms
MMRRC Submission 039510-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87489087-87497093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87489723 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 409 (T409A)
Ref Sequence ENSEMBL: ENSMUSP00000026957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026957]
Predicted Effect probably benign
Transcript: ENSMUST00000026957
AA Change: T409A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026957
Gene: ENSMUSG00000025839
AA Change: T409A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 207 407 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148030
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Pramel7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Pramel7 APN 2 87491085 missense probably damaging 1.00
IGL01302:Pramel7 APN 2 87491373 missense possibly damaging 0.58
IGL01365:Pramel7 APN 2 87491413 splice site probably benign
IGL01728:Pramel7 APN 2 87491330 missense possibly damaging 0.95
IGL01769:Pramel7 APN 2 87489588 missense probably benign 0.09
IGL01932:Pramel7 APN 2 87491113 missense possibly damaging 0.80
IGL02971:Pramel7 APN 2 87490073 missense probably benign 0.03
IGL03376:Pramel7 APN 2 87489603 missense probably damaging 1.00
IGL03380:Pramel7 APN 2 87491372 missense probably benign 0.38
R0625:Pramel7 UTSW 2 87491008 missense probably benign 0.02
R1077:Pramel7 UTSW 2 87491190 missense probably damaging 1.00
R1666:Pramel7 UTSW 2 87492403 missense probably damaging 0.99
R1863:Pramel7 UTSW 2 87491331 missense probably benign 0.35
R1977:Pramel7 UTSW 2 87491121 missense probably benign 0.01
R2141:Pramel7 UTSW 2 87489977 missense probably damaging 1.00
R3027:Pramel7 UTSW 2 87491403 missense probably benign 0.01
R4374:Pramel7 UTSW 2 87490071 missense probably benign 0.05
R4735:Pramel7 UTSW 2 87490843 nonsense probably null
R5232:Pramel7 UTSW 2 87489976 missense probably damaging 0.97
R6255:Pramel7 UTSW 2 87489663 missense probably benign 0.00
R6611:Pramel7 UTSW 2 87490049 missense probably damaging 1.00
R6898:Pramel7 UTSW 2 87489726 missense probably damaging 0.98
R7246:Pramel7 UTSW 2 87492165 missense probably damaging 1.00
R7293:Pramel7 UTSW 2 87492362 missense probably benign 0.28
R7408:Pramel7 UTSW 2 87490845 missense possibly damaging 0.89
R7431:Pramel7 UTSW 2 87489938 missense possibly damaging 0.65
R7469:Pramel7 UTSW 2 87491404 missense probably benign 0.01
R8300:Pramel7 UTSW 2 87489623 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGGCACAAACAAAGTGTGACATC -3'
(R):5'- ACTTGGAGTCATTTGCCCAGCG -3'

Sequencing Primer
(F):5'- AGTGTGACATCCCCATCATC -3'
(R):5'- ACATCTATGCTTGAGAGGTGTCAC -3'
Posted On2014-03-14