Incidental Mutation 'R1455:Ddah1'
ID161710
Institutional Source Beutler Lab
Gene Symbol Ddah1
Ensembl Gene ENSMUSG00000028194
Gene Namedimethylarginine dimethylaminohydrolase 1
Synonyms2410006N07Rik, 2510015N06Rik
MMRRC Submission 039510-MU
Accession Numbers

NCBI RefSeq: NM_026993.3; MGI: 1916469

Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145758675-145894277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 145889109 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 208 (R208L)
Ref Sequence ENSEMBL: ENSMUSP00000029845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029845] [ENSMUST00000120310]
Predicted Effect probably benign
Transcript: ENSMUST00000029845
AA Change: R208L

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029845
Gene: ENSMUSG00000028194
AA Change: R208L

DomainStartEndE-ValueType
Pfam:Amidinotransf 12 279 9.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120310
AA Change: R105L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112747
Gene: ENSMUSG00000028194
AA Change: R105L

DomainStartEndE-ValueType
Pfam:Amidinotransf 1 178 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127193
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype Strain: 3711768; 5424370
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both heterozygous and homozygous inactivation of this gene leads to increased plasma asymmetrical dimethylarginine (ADMA) levels, reduced cardiovascular nitric oxide production, and increased blood pressure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Ddah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Ddah1 APN 3 145759087 missense probably benign 0.44
P0014:Ddah1 UTSW 3 145853158 missense probably benign 0.36
R1386:Ddah1 UTSW 3 145889211 missense probably benign 0.00
R1464:Ddah1 UTSW 3 145853274 nonsense probably null
R1464:Ddah1 UTSW 3 145853274 nonsense probably null
R1557:Ddah1 UTSW 3 145891472 missense probably benign 0.00
R1724:Ddah1 UTSW 3 145891506 missense probably damaging 0.99
R1853:Ddah1 UTSW 3 145891549 missense probably benign
R3700:Ddah1 UTSW 3 145891495 missense probably benign
R6170:Ddah1 UTSW 3 145891506 missense probably benign 0.06
R7603:Ddah1 UTSW 3 145759019 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAAACTTCCAGCCAGATTTCTGCAC -3'
(R):5'- GCCATTCCATCATGAGAAGGTCCC -3'

Sequencing Primer
(F):5'- TCATAAGATCCCTGCTAGGTCAG -3'
(R):5'- CATCATGAGAAGGTCCCCAGAG -3'
Posted On2014-03-14