Incidental Mutation 'R1455:Olfr303'
ID161722
Institutional Source Beutler Lab
Gene Symbol Olfr303
Ensembl Gene ENSMUSG00000039608
Gene Nameolfactory receptor 303
SynonymsGA_x6K02T2NHDJ-9712819-9713778, MOR104-2
MMRRC Submission 039510-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86391810-86397789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86394595 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 301 (F301Y)
Ref Sequence ENSEMBL: ENSMUSP00000149419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]
Predicted Effect probably damaging
Transcript: ENSMUST00000053958
AA Change: F301Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: F301Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-52 PFAM
Pfam:7tm_1 41 307 4.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215234
AA Change: F301Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215532
AA Change: F301Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215733
AA Change: F301Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216409
AA Change: F301Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Olfr303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Olfr303 APN 7 86395078 missense possibly damaging 0.50
IGL02902:Olfr303 APN 7 86394535 utr 3 prime probably benign
IGL02937:Olfr303 APN 7 86394590 missense possibly damaging 0.89
BB001:Olfr303 UTSW 7 86394730 missense probably damaging 1.00
BB011:Olfr303 UTSW 7 86394730 missense probably damaging 1.00
R1524:Olfr303 UTSW 7 86394812 missense probably benign 0.01
R1762:Olfr303 UTSW 7 86395145 missense probably damaging 0.97
R3014:Olfr303 UTSW 7 86394676 missense probably benign 0.19
R3027:Olfr303 UTSW 7 86394553 missense probably benign 0.00
R4073:Olfr303 UTSW 7 86394947 missense probably damaging 0.98
R4502:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4503:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4607:Olfr303 UTSW 7 86394510 splice site probably null
R4608:Olfr303 UTSW 7 86394510 splice site probably null
R7134:Olfr303 UTSW 7 86395544 start gained probably benign
R7298:Olfr303 UTSW 7 86394923 missense probably damaging 1.00
R7827:Olfr303 UTSW 7 86394557 nonsense probably null
R7924:Olfr303 UTSW 7 86394730 missense probably damaging 1.00
R8160:Olfr303 UTSW 7 86395265 missense possibly damaging 0.61
R8294:Olfr303 UTSW 7 86395279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGGAAAATCTCCAGCGCC -3'
(R):5'- TGCCTCCCATCTCACAGTAGTGAC -3'

Sequencing Primer
(F):5'- ATGAACCAGTGAGCCTGC -3'
(R):5'- CAGTAGTGACCATCTACTATGGC -3'
Posted On2014-03-14