Incidental Mutation 'R1455:Map6'
ID 161724
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 039510-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1455 (G1)
Quality Score 122
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98917421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 65 (T65A)
Ref Sequence ENSEMBL: ENSMUSP00000146585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: T65A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: T65A

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: T65A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: T65A

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: T65A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180761
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: T65A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,824 (GRCm39) N285D possibly damaging Het
Adam9 T G 8: 25,483,125 (GRCm39) M227L probably benign Het
Ankrd35 A G 3: 96,585,471 (GRCm39) D21G probably damaging Het
Arhgap32 C T 9: 32,171,381 (GRCm39) A1387V probably benign Het
Atg4d T A 9: 21,182,097 (GRCm39) V306E probably damaging Het
Brsk1 G A 7: 4,707,250 (GRCm39) V268M probably damaging Het
Cfap300 T G 9: 8,022,457 (GRCm39) N255T probably benign Het
Clec4a4 A G 6: 122,989,758 (GRCm39) E133G possibly damaging Het
Col24a1 T A 3: 145,166,593 (GRCm39) L1076H probably damaging Het
Ddah1 G T 3: 145,594,864 (GRCm39) R208L probably benign Het
Dysf A G 6: 84,090,368 (GRCm39) N960S probably benign Het
Egln2 A G 7: 26,859,796 (GRCm39) Y306H probably damaging Het
Fgfr1 T C 8: 26,052,292 (GRCm39) V293A possibly damaging Het
Gja3 A G 14: 57,273,842 (GRCm39) Y177H probably damaging Het
Glul T A 1: 153,782,845 (GRCm39) probably null Het
Gprc5a G A 6: 135,056,245 (GRCm39) V231I probably benign Het
Kdm4d C A 9: 14,375,691 (GRCm39) A56S probably damaging Het
Lingo4 G A 3: 94,306,699 (GRCm39) probably benign Het
Mmrn2 T C 14: 34,121,089 (GRCm39) I653T probably benign Het
Ndufa12 A G 10: 94,039,176 (GRCm39) T70A probably benign Het
Nfe2l3 C A 6: 51,434,744 (GRCm39) P435T possibly damaging Het
Npc1l1 A T 11: 6,178,174 (GRCm39) V412E possibly damaging Het
Or51a39 A T 7: 102,363,205 (GRCm39) Y138* probably null Het
Or6aa1 A T 7: 86,043,803 (GRCm39) F301Y probably damaging Het
Pcnx1 T C 12: 82,020,008 (GRCm39) F1344L probably damaging Het
Pi4ka A G 16: 17,181,818 (GRCm39) V297A probably benign Het
Pole2 G A 12: 69,254,703 (GRCm39) L381F probably benign Het
Pramel7 T C 2: 87,320,067 (GRCm39) T409A probably benign Het
Proc C G 18: 32,256,451 (GRCm39) M405I probably damaging Het
Serinc2 C A 4: 130,158,133 (GRCm39) A105S probably damaging Het
Slc4a10 G T 2: 62,117,274 (GRCm39) K744N probably damaging Het
Spdye4c A T 2: 128,438,478 (GRCm39) I279F probably damaging Het
Srcap G T 7: 127,129,822 (GRCm39) R568L probably damaging Het
Stag3 T A 5: 138,309,997 (GRCm39) M1215K probably benign Het
Tenm3 C T 8: 48,732,083 (GRCm39) A1274T possibly damaging Het
Tet2 A G 3: 133,179,406 (GRCm39) V1253A possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trip12 T C 1: 84,736,821 (GRCm39) I800V probably benign Het
Zfc3h1 T C 10: 115,248,013 (GRCm39) I1072T probably benign Het
Zfp148 T A 16: 33,315,835 (GRCm39) probably null Het
Zfp941 A G 7: 140,392,687 (GRCm39) V224A probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTTGTGGCTAACATGGCG -3'
(R):5'- CATCAGCAGAAAGTTGCATGGGC -3'

Sequencing Primer
(F):5'- TGGCCGTGCATCACAAG -3'
(R):5'- AGTCGCAGGGATTTGCAC -3'
Posted On 2014-03-14