Incidental Mutation 'R1455:Kdm4d'
ID161733
Institutional Source Beutler Lab
Gene Symbol Kdm4d
Ensembl Gene ENSMUSG00000053914
Gene Namelysine (K)-specific demethylase 4D
SynonymsJmjd2d
MMRRC Submission 039510-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14462548-14500482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14464395 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 56 (A56S)
Ref Sequence ENSEMBL: ENSMUSP00000061632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058796] [ENSMUST00000115647]
Predicted Effect probably damaging
Transcript: ENSMUST00000058796
AA Change: A56S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061632
Gene: ENSMUSG00000053914
AA Change: A56S

DomainStartEndE-ValueType
Pfam:JmjN 16 50 3.3e-15 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115647
AA Change: A56S

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111311
Gene: ENSMUSG00000053914
AA Change: A56S

DomainStartEndE-ValueType
Pfam:JmjN 16 50 1.1e-16 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of histone 3 methylation in spermatids, a transient increase in testes size, wider tubules, occasional male germ cell apoptosis, and decreased body weight. However, fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Kdm4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kdm4d APN 9 14464219 missense probably benign 0.10
IGL01114:Kdm4d APN 9 14464197 missense probably damaging 1.00
IGL01609:Kdm4d APN 9 14464418 missense probably damaging 0.99
IGL02342:Kdm4d APN 9 14463564 missense probably damaging 0.99
IGL02513:Kdm4d APN 9 14464554 missense probably benign 0.00
IGL03276:Kdm4d APN 9 14464542 missense probably benign 0.04
IGL03379:Kdm4d APN 9 14463843 missense probably damaging 1.00
R0220:Kdm4d UTSW 9 14463122 missense probably benign
R0755:Kdm4d UTSW 9 14464295 missense probably damaging 0.99
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1552:Kdm4d UTSW 9 14464029 missense probably damaging 1.00
R1692:Kdm4d UTSW 9 14464511 missense probably benign 0.43
R1871:Kdm4d UTSW 9 14464383 missense probably damaging 1.00
R1892:Kdm4d UTSW 9 14464317 missense probably benign 0.14
R4792:Kdm4d UTSW 9 14463390 missense probably benign
R5113:Kdm4d UTSW 9 14464113 missense probably damaging 1.00
R5211:Kdm4d UTSW 9 14463104 missense probably benign 0.04
R5352:Kdm4d UTSW 9 14464358 missense probably damaging 1.00
R6692:Kdm4d UTSW 9 14463065 missense probably benign
R7014:Kdm4d UTSW 9 14464179 missense probably damaging 0.99
R7198:Kdm4d UTSW 9 14464020 missense probably damaging 1.00
R7260:Kdm4d UTSW 9 14463158 missense probably benign 0.05
R8116:Kdm4d UTSW 9 14463941 missense probably damaging 1.00
R8134:Kdm4d UTSW 9 14463236 missense probably damaging 1.00
R8354:Kdm4d UTSW 9 14463939 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGTGACTCATACAGGCGATTCTTCC -3'
(R):5'- ATCACATGCACAGAGGCTGTCAGG -3'

Sequencing Primer
(F):5'- CTTCAAAATCCAGGTGTGGC -3'
(R):5'- AGGAGATTCGGCTCCATCAC -3'
Posted On2014-03-14