Mutagenetix > Incidental Mutation

Incidental Mutation 'R1455:Arhgap32'

161735

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, PX-RICS, GC-GAP, 3426406O18Rik

MMRRC Submission

039510-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1455 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32027432-32179742 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32171381 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1387 (A1387V)

Ref Sequence

ENSEMBL: ENSMUSP00000138145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]

AlphaFold

Q811P8

Predicted Effect

probably benign
Transcript: ENSMUST00000168954
AA Change: A1387V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: A1387V

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174641
AA Change: A1736V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: A1736V

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182802
AA Change: A1387V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: A1387V

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.8%
20x: 87.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,314,824 (GRCm39)	N285D	possibly damaging	Het
Adam9	T	G	8: 25,483,125 (GRCm39)	M227L	probably benign	Het
Ankrd35	A	G	3: 96,585,471 (GRCm39)	D21G	probably damaging	Het
Atg4d	T	A	9: 21,182,097 (GRCm39)	V306E	probably damaging	Het
Brsk1	G	A	7: 4,707,250 (GRCm39)	V268M	probably damaging	Het
Cfap300	T	G	9: 8,022,457 (GRCm39)	N255T	probably benign	Het
Clec4a4	A	G	6: 122,989,758 (GRCm39)	E133G	possibly damaging	Het
Col24a1	T	A	3: 145,166,593 (GRCm39)	L1076H	probably damaging	Het
Ddah1	G	T	3: 145,594,864 (GRCm39)	R208L	probably benign	Het
Dysf	A	G	6: 84,090,368 (GRCm39)	N960S	probably benign	Het
Egln2	A	G	7: 26,859,796 (GRCm39)	Y306H	probably damaging	Het
Fgfr1	T	C	8: 26,052,292 (GRCm39)	V293A	possibly damaging	Het
Gja3	A	G	14: 57,273,842 (GRCm39)	Y177H	probably damaging	Het
Glul	T	A	1: 153,782,845 (GRCm39)		probably null	Het
Gprc5a	G	A	6: 135,056,245 (GRCm39)	V231I	probably benign	Het
Kdm4d	C	A	9: 14,375,691 (GRCm39)	A56S	probably damaging	Het
Lingo4	G	A	3: 94,306,699 (GRCm39)		probably benign	Het
Map6	A	G	7: 98,917,421 (GRCm39)	T65A	probably damaging	Het
Mmrn2	T	C	14: 34,121,089 (GRCm39)	I653T	probably benign	Het
Ndufa12	A	G	10: 94,039,176 (GRCm39)	T70A	probably benign	Het
Nfe2l3	C	A	6: 51,434,744 (GRCm39)	P435T	possibly damaging	Het
Npc1l1	A	T	11: 6,178,174 (GRCm39)	V412E	possibly damaging	Het
Or51a39	A	T	7: 102,363,205 (GRCm39)	Y138*	probably null	Het
Or6aa1	A	T	7: 86,043,803 (GRCm39)	F301Y	probably damaging	Het
Pcnx1	T	C	12: 82,020,008 (GRCm39)	F1344L	probably damaging	Het
Pi4ka	A	G	16: 17,181,818 (GRCm39)	V297A	probably benign	Het
Pole2	G	A	12: 69,254,703 (GRCm39)	L381F	probably benign	Het
Pramel7	T	C	2: 87,320,067 (GRCm39)	T409A	probably benign	Het
Proc	C	G	18: 32,256,451 (GRCm39)	M405I	probably damaging	Het
Serinc2	C	A	4: 130,158,133 (GRCm39)	A105S	probably damaging	Het
Slc4a10	G	T	2: 62,117,274 (GRCm39)	K744N	probably damaging	Het
Spdye4c	A	T	2: 128,438,478 (GRCm39)	I279F	probably damaging	Het
Srcap	G	T	7: 127,129,822 (GRCm39)	R568L	probably damaging	Het
Stag3	T	A	5: 138,309,997 (GRCm39)	M1215K	probably benign	Het
Tenm3	C	T	8: 48,732,083 (GRCm39)	A1274T	possibly damaging	Het
Tet2	A	G	3: 133,179,406 (GRCm39)	V1253A	possibly damaging	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Trip12	T	C	1: 84,736,821 (GRCm39)	I800V	probably benign	Het
Zfc3h1	T	C	10: 115,248,013 (GRCm39)	I1072T	probably benign	Het
Zfp148	T	A	16: 33,315,835 (GRCm39)		probably null	Het
Zfp941	A	G	7: 140,392,687 (GRCm39)	V224A	probably benign	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32,168,657 (GRCm39)	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32,168,260 (GRCm39)	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32,171,801 (GRCm39)	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32,158,486 (GRCm39)	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32,170,627 (GRCm39)	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32,166,944 (GRCm39)	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32,158,490 (GRCm39)	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32,157,302 (GRCm39)	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32,172,431 (GRCm39)	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32,170,430 (GRCm39)	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32,170,816 (GRCm39)	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32,172,152 (GRCm39)	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32,063,294 (GRCm39)	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32,171,056 (GRCm39)	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32,157,773 (GRCm39)	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32,156,551 (GRCm39)	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32,170,199 (GRCm39)	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32,101,364 (GRCm39)	splice site	probably benign
R0856:Arhgap32	UTSW	9	32,171,516 (GRCm39)	missense	probably damaging	1.00
R0990:Arhgap32	UTSW	9	32,166,677 (GRCm39)	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32,166,608 (GRCm39)	missense	probably benign
R1515:Arhgap32	UTSW	9	32,027,498 (GRCm39)	missense	probably benign
R1523:Arhgap32	UTSW	9	32,168,048 (GRCm39)	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32,171,096 (GRCm39)	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32,170,727 (GRCm39)	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32,027,436 (GRCm39)	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32,171,207 (GRCm39)	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32,027,436 (GRCm39)	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32,158,793 (GRCm39)	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32,158,793 (GRCm39)	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32,150,694 (GRCm39)	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32,063,315 (GRCm39)	splice site	probably null
R3793:Arhgap32	UTSW	9	32,166,669 (GRCm39)	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32,101,320 (GRCm39)	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32,158,362 (GRCm39)	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32,158,510 (GRCm39)	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32,168,770 (GRCm39)	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32,171,185 (GRCm39)	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32,093,135 (GRCm39)	splice site	probably null
R4587:Arhgap32	UTSW	9	32,172,241 (GRCm39)	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32,170,775 (GRCm39)	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32,150,644 (GRCm39)	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32,081,441 (GRCm39)	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32,172,076 (GRCm39)	missense	probably damaging	1.00
R4784:Arhgap32	UTSW	9	32,040,949 (GRCm39)	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32,172,076 (GRCm39)	missense	probably damaging	1.00
R4785:Arhgap32	UTSW	9	32,040,949 (GRCm39)	missense	probably damaging	0.99
R4906:Arhgap32	UTSW	9	32,156,552 (GRCm39)	critical splice donor site	probably null
R5046:Arhgap32	UTSW	9	32,168,095 (GRCm39)	missense	probably damaging	1.00
R5360:Arhgap32	UTSW	9	32,170,967 (GRCm39)	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32,063,306 (GRCm39)	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32,159,678 (GRCm39)	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32,158,502 (GRCm39)	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32,093,256 (GRCm39)	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32,167,084 (GRCm39)	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32,168,275 (GRCm39)	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32,171,407 (GRCm39)	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32,159,784 (GRCm39)	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32,063,983 (GRCm39)	missense	possibly damaging	0.86
R7009:Arhgap32	UTSW	9	32,157,272 (GRCm39)	missense	probably damaging	1.00
R7137:Arhgap32	UTSW	9	32,063,232 (GRCm39)	missense	probably benign	0.32
R7183:Arhgap32	UTSW	9	32,097,679 (GRCm39)	missense	probably benign	0.15
R7251:Arhgap32	UTSW	9	32,119,481 (GRCm39)	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32,063,993 (GRCm39)	missense
R7289:Arhgap32	UTSW	9	32,168,234 (GRCm39)	missense	probably benign	0.02
R7289:Arhgap32	UTSW	9	32,168,233 (GRCm39)	missense	possibly damaging	0.92
R7391:Arhgap32	UTSW	9	32,093,235 (GRCm39)	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32,157,220 (GRCm39)	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32,162,018 (GRCm39)	missense	probably benign	0.10
R7584:Arhgap32	UTSW	9	32,168,263 (GRCm39)	missense	probably benign	0.16
R7653:Arhgap32	UTSW	9	32,168,441 (GRCm39)	missense	probably benign
R7884:Arhgap32	UTSW	9	32,171,810 (GRCm39)	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32,168,324 (GRCm39)	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32,093,150 (GRCm39)	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32,158,426 (GRCm39)	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32,093,196 (GRCm39)	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32,168,198 (GRCm39)	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32,172,205 (GRCm39)	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32,167,233 (GRCm39)	nonsense	probably null
R8696:Arhgap32	UTSW	9	32,159,799 (GRCm39)	missense	possibly damaging	0.90
R8832:Arhgap32	UTSW	9	32,172,115 (GRCm39)	missense	possibly damaging	0.94
R9112:Arhgap32	UTSW	9	32,157,309 (GRCm39)	missense	probably damaging	0.99
R9170:Arhgap32	UTSW	9	32,162,039 (GRCm39)	missense	possibly damaging	0.47
R9279:Arhgap32	UTSW	9	32,168,655 (GRCm39)	missense	probably benign	0.01
R9431:Arhgap32	UTSW	9	32,170,463 (GRCm39)	missense	probably damaging	1.00
R9522:Arhgap32	UTSW	9	32,027,450 (GRCm39)	missense	probably benign
R9526:Arhgap32	UTSW	9	32,172,026 (GRCm39)	missense	probably benign	0.28
R9661:Arhgap32	UTSW	9	32,168,531 (GRCm39)	missense	probably benign	0.01
X0027:Arhgap32	UTSW	9	32,161,937 (GRCm39)	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32,172,365 (GRCm39)	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32,171,976 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGATGTCGATGCCTATGGCACAG -3'
(R):5'- GCCACAGAGAGAAGTCCAGTTTTCC -3'

Sequencing Primer
(F):5'- ATGCCTATGGCACAGTCCAG -3'
(R):5'- CCCAGGATCTGATTTGCTGC -3'

Posted On

2014-03-14