Incidental Mutation 'R1455:Npc1l1'
ID161739
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission 039510-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6228174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 412 (V412E)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004505
AA Change: V412E

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: V412E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGGTCCTTCCAGTCCACCAG -3'
(R):5'- CGTAAGCGCAGATTCTCACCTCAC -3'

Sequencing Primer
(F):5'- TTGACACAGCAGTCAGTGAG -3'
(R):5'- TCTTCGAGAGCTGGGGAAC -3'
Posted On2014-03-14