Incidental Mutation 'R1455:Pole2'
ID 161741
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Name polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms DNA polymerase epsilon small subunit
MMRRC Submission 039510-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1455 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 69201773-69228195 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69207929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 381 (L381F)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
AlphaFold O54956
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: L381F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: L381F

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: L381F

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221986
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0574:Pole2 UTSW 12 69211457 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0685:Pole2 UTSW 12 69211413 missense probably damaging 0.98
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1452:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R2929:Pole2 UTSW 12 69209938 missense probably benign 0.13
R3016:Pole2 UTSW 12 69222062 missense probably benign 0.14
R4504:Pole2 UTSW 12 69222468 missense probably benign 0.00
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
R7535:Pole2 UTSW 12 69222429 missense probably benign 0.10
R7841:Pole2 UTSW 12 69204258 missense probably damaging 1.00
R8437:Pole2 UTSW 12 69204187 nonsense probably null
R8506:Pole2 UTSW 12 69208960 missense probably benign
R9467:Pole2 UTSW 12 69208945 missense probably benign 0.40
R9494:Pole2 UTSW 12 69202957 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAAGCTGGAGATACCACTGCCAAC -3'
(R):5'- AACTGTAGCTAGGCATCATGGCCC -3'

Sequencing Primer
(F):5'- CAGAGTCACTGCTGGTTAAGTATC -3'
(R):5'- ctagcctagactacatagcaagac -3'
Posted On 2014-03-14