Incidental Mutation 'R1456:Scn10a'
ID161797
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission 039511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1456 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119691478 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 119 (I119V)
Ref Sequence ENSEMBL: ENSMUSP00000081845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably benign
Transcript: ENSMUST00000084787
AA Change: I119V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: I119V

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213392
AA Change: I119V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213401
Predicted Effect probably benign
Transcript: ENSMUST00000214408
AA Change: I119V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216583
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,480,920 probably null Het
4930563D23Rik T A 16: 92,320,665 Y245F probably damaging Het
4932414N04Rik A T 2: 68,716,214 E80V possibly damaging Het
Alkbh3 A G 2: 94,001,419 probably null Het
Ankar A T 1: 72,665,118 Y881N probably benign Het
Arhgap18 T C 10: 26,916,440 I629T probably benign Het
Arhgef28 C T 13: 98,075,002 E158K probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Birc6 A G 17: 74,609,290 I427V probably benign Het
Camk4 A G 18: 33,129,843 probably benign Het
Ccdc178 A T 18: 22,150,424 D16E possibly damaging Het
Cct6b G T 11: 82,753,620 probably benign Het
Ccz1 A G 5: 144,011,018 probably benign Het
Cdh23 T C 10: 60,487,120 N335S possibly damaging Het
Cemip T A 7: 83,998,510 S121C possibly damaging Het
Cers1 A G 8: 70,331,188 E262G probably damaging Het
Clec11a G T 7: 44,306,450 P58T possibly damaging Het
Clec16a T C 16: 10,691,555 I797T probably damaging Het
Col4a1 A C 8: 11,242,829 probably benign Het
Colgalt2 G A 1: 152,484,904 V231I probably damaging Het
D430041D05Rik G T 2: 104,208,083 N1580K probably damaging Het
Dcdc5 A G 2: 106,351,565 noncoding transcript Het
Ddx17 T C 15: 79,530,376 D532G probably benign Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah3 A G 7: 120,047,630 Y1059H probably damaging Het
Dtx1 C A 5: 120,710,504 probably benign Het
Egfr A G 11: 16,863,065 S182G probably benign Het
Fads1 A G 19: 10,185,752 N131S probably benign Het
Fancm C T 12: 65,118,351 A1490V possibly damaging Het
Fsd2 C A 7: 81,559,591 E168* probably null Het
Gm20388 T C 8: 122,841,948 probably benign Het
Gm9772 A T 17: 22,007,118 C62S probably damaging Het
H60c C T 10: 3,260,307 A81T possibly damaging Het
Hira T G 16: 18,925,663 S377A probably benign Het
Iffo1 T C 6: 125,145,914 S220P possibly damaging Het
Itih4 A G 14: 30,892,653 M491V probably benign Het
Khdrbs2 T C 1: 32,520,696 R102G possibly damaging Het
Klhdc7a T G 4: 139,965,524 Y704S possibly damaging Het
Klk1b21 G A 7: 44,105,499 V73I probably benign Het
Krt42 G A 11: 100,269,609 A88V probably benign Het
Krt42 C T 11: 100,269,610 A88T probably benign Het
Limk1 G T 5: 134,657,510 D580E probably benign Het
Lipk C T 19: 34,046,785 P323S probably damaging Het
Lipo5 T A 19: 33,465,873 probably benign Het
Llgl2 A G 11: 115,845,499 D166G probably benign Het
Mapk8ip3 A T 17: 24,906,949 N447K probably damaging Het
Mapkbp1 C T 2: 119,973,145 R32W probably damaging Het
Med23 T A 10: 24,903,652 probably benign Het
Mrgprb1 A T 7: 48,448,029 M45K probably damaging Het
Mroh7 G A 4: 106,695,141 probably benign Het
Mrpl27 G A 11: 94,653,833 R11Q probably benign Het
Ms4a10 T A 19: 10,964,733 T175S possibly damaging Het
Muc3 T C 5: 137,137,951 H330R probably benign Het
Myo15 A T 11: 60,508,202 I2787F probably damaging Het
Ndst1 A G 18: 60,713,205 C11R possibly damaging Het
Obsl1 C A 1: 75,487,656 G1669* probably null Het
Olfr477 A G 7: 107,990,398 E11G probably benign Het
Olfr784 A T 10: 129,387,783 D50V probably damaging Het
Olfr873 T C 9: 20,300,838 Y214H probably benign Het
Pafah2 T A 4: 134,404,157 I77N probably damaging Het
Pcsk6 A T 7: 66,043,535 I693F possibly damaging Het
Pde4c G T 8: 70,746,613 R228L probably benign Het
Pdzd8 T C 19: 59,300,472 N832S probably benign Het
Plbd1 T A 6: 136,613,816 M451L probably benign Het
Pramef17 G T 4: 143,993,281 D171E probably benign Het
Prom1 T C 5: 44,037,623 D269G probably damaging Het
Ranbp17 A G 11: 33,266,310 S813P probably damaging Het
Sh3pxd2b A G 11: 32,415,967 T353A probably damaging Het
Shq1 A T 6: 100,669,698 probably null Het
Slc22a28 T A 19: 8,071,858 H342L possibly damaging Het
Slco2b1 C T 7: 99,664,907 E9K probably null Het
Specc1l T C 10: 75,246,284 F505L probably damaging Het
Sptan1 G T 2: 29,980,203 probably null Het
St6gal2 A G 17: 55,490,931 probably benign Het
Taok2 T C 7: 126,880,141 I73V probably benign Het
Tax1bp1 C T 6: 52,744,244 T478I probably benign Het
Tbc1d4 A T 14: 101,507,106 N361K probably damaging Het
Tph1 A T 7: 46,647,483 Y429* probably null Het
Tprkb A T 6: 85,924,421 R14W probably damaging Het
Trio A T 15: 27,753,804 probably benign Het
Ttc23 T C 7: 67,667,154 probably benign Het
Vmn1r211 T C 13: 22,852,245 Y84C probably damaging Het
Vmn2r22 C G 6: 123,637,665 G322A possibly damaging Het
Wdr74 A G 19: 8,740,412 Q330R probably benign Het
Wdtc1 C A 4: 133,297,428 S486I possibly damaging Het
Zbtb24 T C 10: 41,464,993 V673A possibly damaging Het
Zfpm2 A T 15: 41,102,481 R787S probably damaging Het
Zkscan5 A G 5: 145,220,988 N694D probably benign Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 unclassified probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 unclassified probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 unclassified probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 unclassified probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
Possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGGCATCAGTAAAACTCACGC -3'
(R):5'- TTCATAGTCAGCCACGGAGTCCAC -3'

Sequencing Primer
(F):5'- GTACCACCAACCGTGCTTTC -3'
(R):5'- CTAGACGCTCAGTGAGCTGTG -3'
Posted OnMar 14, 2014