Incidental Mutation 'R1456:Scn10a'
ID161797
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission 039511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R1456 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119608456-119719032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119691478 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 119 (I119V)
Ref Sequence ENSEMBL: ENSMUSP00000081845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably benign
Transcript: ENSMUST00000084787
AA Change: I119V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: I119V

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213392
AA Change: I119V

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000214408
AA Change: I119V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
MGI Phenotype Homozygotes for a targeted null mutation exhibit impaired perception of pain.
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,480,920 probably null Het
4930563D23Rik T A 16: 92,320,665 Y245F probably damaging Het
4932414N04Rik A T 2: 68,716,214 E80V possibly damaging Het
Alkbh3 A G 2: 94,001,419 probably null Het
Ankar A T 1: 72,665,118 Y881N probably benign Het
Arhgap18 T C 10: 26,916,440 I629T probably benign Het
Arhgef28 C T 13: 98,075,002 E158K probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Birc6 A G 17: 74,609,290 I427V probably benign Het
Camk4 A G 18: 33,129,843 unknown Het
Ccdc178 A T 18: 22,150,424 D16E possibly damaging Het
Cct6b G T 11: 82,753,620 unknown Het
Ccz1 A G 5: 144,011,018 noncoding transcript Het
Cdh23 T C 10: 60,487,120 N335S possibly damaging Het
Cemip T A 7: 83,998,510 S121C possibly damaging Het
Cers1 A G 8: 70,331,188 E262G probably damaging Het
Clec11a G T 7: 44,306,450 P58T possibly damaging Het
Clec16a T C 16: 10,691,555 I797T probably damaging Het
Col4a1 A C 8: 11,242,829 noncoding transcript Het
Colgalt2 G A 1: 152,484,904 V231I probably damaging Het
D430041D05Rik G T 2: 104,208,083 N895K probably damaging Het
Dcdc5 A G 2: 106,351,565 noncoding transcript Het
Ddx17 T C 15: 79,530,376 D532G probably benign Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah3 A G 7: 120,047,630 Y1059H probably damaging Het
Dtx1 C A 5: 120,710,504 unknown Het
Egfr A G 11: 16,863,065 S182G probably benign Het
Fads1 A G 19: 10,185,752 N131S probably benign Het
Fancm C T 12: 65,118,351 A1490V possibly damaging Het
Fsd2 C A 7: 81,559,591 E168* probably null Het
Gm20388 T C 8: 122,841,948 noncoding transcript Het
Gm9772 A T 17: 22,007,118 C62S probably damaging Het
H60c C T 10: 3,260,307 A81T possibly damaging Het
Hira T G 16: 18,925,663 S377A probably benign Het
Iffo1 T C 6: 125,145,914 S220P possibly damaging Het
Itih4 A G 14: 30,892,653 M491V probably benign Het
Khdrbs2 T C 1: 32,520,696 R102G possibly damaging Het
Klhdc7a T G 4: 139,965,524 Y704S possibly damaging Het
Klk1b21 G A 7: 44,105,499 V73I probably benign Het
Krt42 G A 11: 100,269,609 A88V probably benign Het
Krt42 C T 11: 100,269,610 A88T probably benign Het
Limk1 G T 5: 134,657,510 D580E probably benign Het
Lipk C T 19: 34,046,785 P323S probably damaging Het
Lipo5 T A 19: 33,465,873 unknown Het
Llgl2 A G 11: 115,845,499 D166G probably benign Het
Mapk8ip3 A T 17: 24,906,949 N447K probably damaging Het
Mapkbp1 C T 2: 119,973,145 R32W probably damaging Het
Med23 T A 10: 24,903,652 unknown Het
Mrgprb1 A T 7: 48,448,029 M45K probably damaging Het
Mroh7 G A 4: 106,695,141 noncoding transcript Het
Mrpl27 G A 11: 94,653,833 R11Q unknown Het
Ms4a10 T A 19: 10,964,733 T175S possibly damaging Het
Muc3 T C 5: 137,137,951 H330R noncoding transcript Het
Myo15 A T 11: 60,508,202 I2787F probably damaging Het
Ndst1 A G 18: 60,713,205 C11R possibly damaging Het
Obsl1 C A 1: 75,487,656 G1669* probably null Het
Olfr477 A G 7: 107,990,398 E11G probably benign Het
Olfr784 A T 10: 129,387,783 D50V probably damaging Het
Olfr873 T C 9: 20,300,838 Y210H probably benign Het
Pafah2 T A 4: 134,404,157 I77N probably damaging Het
Pcsk6 A T 7: 66,043,535 I693F possibly damaging Het
Pde4c G T 8: 70,746,613 R228L probably benign Het
Pdzd8 T C 19: 59,300,472 N832S probably benign Het
Plbd1 T A 6: 136,613,816 M451L probably benign Het
Pramef17 G T 4: 143,993,281 D171E probably benign Het
Prom1 T C 5: 44,037,623 D269G probably damaging Het
Ranbp17 A G 11: 33,266,310 S813P probably damaging Het
Sh3pxd2b A G 11: 32,415,967 T353A probably damaging Het
Shq1 A T 6: 100,669,698 probably null Het
Slc22a28 T A 19: 8,071,858 H342L possibly damaging Het
Slco2b1 C T 7: 99,664,907 E9K probably null Het
Specc1l T C 10: 75,246,284 F505L probably damaging Het
Sptan1 G T 2: 29,980,203 probably null Het
St6gal2 A G 17: 55,490,931 unknown Het
Taok2 T C 7: 126,880,141 I73V probably benign Het
Tax1bp1 C T 6: 52,744,244 T478I probably benign Het
Tbc1d4 A T 14: 101,507,106 N361K probably damaging Het
Tph1 A T 7: 46,647,483 Y429* probably null Het
Tprkb A T 6: 85,924,421 R14W probably damaging Het
Trio A T 15: 27,753,804 unknown Het
Ttc23 T C 7: 67,667,154 noncoding transcript Het
Vmn1r211 T C 13: 22,852,245 Y84C probably damaging Het
Vmn2r22 C G 6: 123,637,665 G322A possibly damaging Het
Wdr74 A G 19: 8,740,412 Q330R probably benign Het
Wdtc1 C A 4: 133,297,428 S486I possibly damaging Het
Zbtb24 T C 10: 41,464,993 V673A possibly damaging Het
Zfpm2 A T 15: 41,102,481 R787S probably damaging Het
Zkscan5 A G 5: 145,220,988 N694D probably benign Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 unclassified probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense possibly damaging 0.71
IGL01539:Scn10a APN 9 119638698 missense possibly damaging 0.95
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 unclassified probably benign 0.08
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense probably benign 0.07
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 unclassified probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 unclassified 0.00
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
Possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense possibly damaging 0.71
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.11
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably benign 0.43
R1945:Scn10a UTSW 9 119691454 missense probably damaging 0.96
R2013:Scn10a UTSW 9 119613736 missense probably benign 0.21
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense possibly damaging 0.80
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.23
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.85
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign 0.23
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense probably benign 0.12
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.49
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense probably damaging 0.99
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense possibly damaging 0.69
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.07
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense probably damaging 0.99
R6156:Scn10a UTSW 9 119635583 missense probably benign
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGGCATCAGTAAAACTCACGC -3'
(R):5'- TTCATAGTCAGCCACGGAGTCCAC -3'

Sequencing Primer
(F):5'- GTACCACCAACCGTGCTTTC -3'
(R):5'- CTAGACGCTCAGTGAGCTGTG -3'
Posted OnMar 14, 2014