Incidental Mutation 'R1456:Zfpm2'
ID 161819
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
MMRRC Submission 039511-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1456 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41102481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 655 (R655S)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably damaging
Transcript: ENSMUST00000053467
AA Change: R787S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: R787S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230319
AA Change: R655S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3424 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,480,920 probably null Het
4930563D23Rik T A 16: 92,320,665 Y245F probably damaging Het
4932414N04Rik A T 2: 68,716,214 E80V possibly damaging Het
Alkbh3 A G 2: 94,001,419 probably null Het
Ankar A T 1: 72,665,118 Y664N probably benign Het
Arhgap18 T C 10: 26,916,440 I629T probably benign Het
Arhgef28 C T 13: 98,075,002 E158K probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Birc6 A G 17: 74,609,290 I427V probably benign Het
Camk4 A G 18: 33,129,843 probably benign Het
Ccdc178 A T 18: 22,150,424 D16E possibly damaging Het
Cct6b G T 11: 82,753,620 probably benign Het
Ccz1 A G 5: 144,011,018 probably benign Het
Cdh23 T C 10: 60,487,120 N335S possibly damaging Het
Cemip T A 7: 83,998,510 S121C possibly damaging Het
Cers1 A G 8: 70,331,188 E262G probably damaging Het
Clec11a G T 7: 44,306,450 P58T possibly damaging Het
Clec16a T C 16: 10,691,555 I797T probably damaging Het
Col4a1 A C 8: 11,242,829 probably benign Het
Colgalt2 G A 1: 152,484,904 V231I probably damaging Het
D430041D05Rik G T 2: 104,208,083 N1580K probably damaging Het
Dcdc5 A G 2: 106,351,565 noncoding transcript Het
Ddx17 T C 15: 79,530,376 D530G probably benign Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah3 A G 7: 120,047,630 Y1059H probably damaging Het
Dtx1 C A 5: 120,710,504 probably benign Het
Egfr A G 11: 16,863,065 S182G probably benign Het
Fads1 A G 19: 10,185,752 N131S probably benign Het
Fancm C T 12: 65,118,351 A1490V possibly damaging Het
Fsd2 C A 7: 81,559,591 E168* probably null Het
Gm20388 T C 8: 122,841,948 probably benign Het
Gm9772 A T 17: 22,007,118 C62S probably damaging Het
H60c C T 10: 3,260,307 A81T possibly damaging Het
Hira T G 16: 18,925,663 S377A probably benign Het
Iffo1 T C 6: 125,145,914 S220P possibly damaging Het
Itih4 A G 14: 30,892,653 M491V probably benign Het
Khdrbs2 T C 1: 32,520,696 R102G possibly damaging Het
Klhdc7a T G 4: 139,965,524 Y704S possibly damaging Het
Klk1b21 G A 7: 44,105,499 V73I probably benign Het
Krt42 G A 11: 100,269,609 A88V probably benign Het
Krt42 C T 11: 100,269,610 A88T probably benign Het
Limk1 G T 5: 134,657,510 D580E probably benign Het
Lipk C T 19: 34,046,785 P323S probably damaging Het
Lipo5 T A 19: 33,465,873 probably benign Het
Llgl2 A G 11: 115,845,499 D166G probably benign Het
Mapk8ip3 A T 17: 24,906,949 N439K probably damaging Het
Mapkbp1 C T 2: 119,973,145 R32W probably damaging Het
Med23 T A 10: 24,903,652 probably benign Het
Mrgprb1 A T 7: 48,448,029 M45K probably damaging Het
Mroh7 G A 4: 106,695,141 probably benign Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Ms4a10 T A 19: 10,964,733 T175S possibly damaging Het
Muc3 T C 5: 137,137,951 H330R probably benign Het
Myo15 A T 11: 60,508,202 I2787F probably damaging Het
Ndst1 A G 18: 60,713,205 C11R possibly damaging Het
Obsl1 C A 1: 75,487,656 G1669* probably null Het
Olfr477 A G 7: 107,990,398 E11G probably benign Het
Olfr784 A T 10: 129,387,783 D50V probably damaging Het
Olfr873 T C 9: 20,300,838 Y214H probably benign Het
Pafah2 T A 4: 134,404,157 I52N probably damaging Het
Pcsk6 A T 7: 66,043,535 I693F possibly damaging Het
Pde4c G T 8: 70,746,613 R228L probably benign Het
Pdzd8 T C 19: 59,300,472 N832S probably benign Het
Plbd1 T A 6: 136,613,816 M451L probably benign Het
Pramef17 G T 4: 143,993,281 D171E probably benign Het
Prom1 T C 5: 44,037,623 D260G probably damaging Het
Ranbp17 A G 11: 33,266,310 S813P probably damaging Het
Scn10a T C 9: 119,691,478 I119V probably benign Het
Sh3pxd2b A G 11: 32,415,967 T353A probably damaging Het
Shq1 A T 6: 100,669,698 probably null Het
Slc22a28 T A 19: 8,071,858 H342L possibly damaging Het
Slco2b1 C T 7: 99,664,907 E9K probably null Het
Specc1l T C 10: 75,246,284 F505L probably damaging Het
Sptan1 G T 2: 29,980,203 probably null Het
St6gal2 A G 17: 55,490,931 probably benign Het
Taok2 T C 7: 126,880,141 I73V probably benign Het
Tax1bp1 C T 6: 52,744,244 T478I probably benign Het
Tbc1d4 A T 14: 101,507,106 N361K probably damaging Het
Tph1 A T 7: 46,647,483 Y429* probably null Het
Tprkb A T 6: 85,924,421 R14W probably damaging Het
Trio A T 15: 27,753,804 probably benign Het
Ttc23 T C 7: 67,667,154 probably benign Het
Vmn1r211 T C 13: 22,852,245 Y84C probably damaging Het
Vmn2r22 C G 6: 123,637,665 G322A possibly damaging Het
Wdr74 A G 19: 8,740,412 Q330R probably benign Het
Wdtc1 C A 4: 133,297,428 S486I possibly damaging Het
Zbtb24 T C 10: 41,464,993 V673A possibly damaging Het
Zkscan5 A G 5: 145,220,988 N694D probably benign Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTACTGTGCAACACGCCATGACCC -3'
(R):5'- TCGTCCGCTCAGACTGCGATAAAC -3'

Sequencing Primer
(F):5'- GGTCTGCTTCCAACAAAGTGC -3'
(R):5'- GACTGCGATAAACACTTTTTGCTG -3'
Posted On 2014-03-14