Incidental Mutation 'R1456:Ddx17'
ID161820
Institutional Source Beutler Lab
Gene Symbol Ddx17
Ensembl Gene ENSMUSG00000055065
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 17
SynonymsA430025E01Rik, 2610007K22Rik, p72, LOC381024
MMRRC Submission 039511-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1456 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79527736-79546741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79530376 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 530 (D530G)
Ref Sequence ENSEMBL: ENSMUSP00000155307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010974] [ENSMUST00000054014] [ENSMUST00000229431] [ENSMUST00000229877] [ENSMUST00000231053]
Predicted Effect probably benign
Transcript: ENSMUST00000010974
SMART Domains Protein: ENSMUSP00000010974
Gene: ENSMUSG00000010830

DomainStartEndE-ValueType
Pfam:ER_lumen_recept 28 169 3.3e-54 PFAM
transmembrane domain 179 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054014
AA Change: D532G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065
AA Change: D532G

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:DEXDc 29 87 7e-18 BLAST
DEXDc 111 314 4.79e-65 SMART
HELICc 353 434 3.34e-32 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 550 576 N/A INTRINSIC
low complexity region 578 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229431
Predicted Effect probably benign
Transcript: ENSMUST00000229877
AA Change: D530G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231053
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes the mouse homolog of human DEAD box polypeptide 17. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD). RNA helicases of the DEAD-box family are involved in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,480,920 probably null Het
4930563D23Rik T A 16: 92,320,665 Y245F probably damaging Het
4932414N04Rik A T 2: 68,716,214 E80V possibly damaging Het
Alkbh3 A G 2: 94,001,419 probably null Het
Ankar A T 1: 72,665,118 Y664N probably benign Het
Arhgap18 T C 10: 26,916,440 I629T probably benign Het
Arhgef28 C T 13: 98,075,002 E158K probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Birc6 A G 17: 74,609,290 I427V probably benign Het
Camk4 A G 18: 33,129,843 probably benign Het
Ccdc178 A T 18: 22,150,424 D16E possibly damaging Het
Cct6b G T 11: 82,753,620 probably benign Het
Ccz1 A G 5: 144,011,018 probably benign Het
Cdh23 T C 10: 60,487,120 N335S possibly damaging Het
Cemip T A 7: 83,998,510 S121C possibly damaging Het
Cers1 A G 8: 70,331,188 E262G probably damaging Het
Clec11a G T 7: 44,306,450 P58T possibly damaging Het
Clec16a T C 16: 10,691,555 I797T probably damaging Het
Col4a1 A C 8: 11,242,829 probably benign Het
Colgalt2 G A 1: 152,484,904 V231I probably damaging Het
D430041D05Rik G T 2: 104,208,083 N1580K probably damaging Het
Dcdc5 A G 2: 106,351,565 noncoding transcript Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah3 A G 7: 120,047,630 Y1059H probably damaging Het
Dtx1 C A 5: 120,710,504 probably benign Het
Egfr A G 11: 16,863,065 S182G probably benign Het
Fads1 A G 19: 10,185,752 N131S probably benign Het
Fancm C T 12: 65,118,351 A1490V possibly damaging Het
Fsd2 C A 7: 81,559,591 E168* probably null Het
Gm20388 T C 8: 122,841,948 probably benign Het
Gm9772 A T 17: 22,007,118 C62S probably damaging Het
H60c C T 10: 3,260,307 A81T possibly damaging Het
Hira T G 16: 18,925,663 S377A probably benign Het
Iffo1 T C 6: 125,145,914 S220P possibly damaging Het
Itih4 A G 14: 30,892,653 M491V probably benign Het
Khdrbs2 T C 1: 32,520,696 R102G possibly damaging Het
Klhdc7a T G 4: 139,965,524 Y704S possibly damaging Het
Klk1b21 G A 7: 44,105,499 V73I probably benign Het
Krt42 G A 11: 100,269,609 A88V probably benign Het
Krt42 C T 11: 100,269,610 A88T probably benign Het
Limk1 G T 5: 134,657,510 D580E probably benign Het
Lipk C T 19: 34,046,785 P323S probably damaging Het
Lipo5 T A 19: 33,465,873 probably benign Het
Llgl2 A G 11: 115,845,499 D166G probably benign Het
Mapk8ip3 A T 17: 24,906,949 N439K probably damaging Het
Mapkbp1 C T 2: 119,973,145 R32W probably damaging Het
Med23 T A 10: 24,903,652 probably benign Het
Mrgprb1 A T 7: 48,448,029 M45K probably damaging Het
Mroh7 G A 4: 106,695,141 probably benign Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Ms4a10 T A 19: 10,964,733 T175S possibly damaging Het
Muc3 T C 5: 137,137,951 H330R probably benign Het
Myo15 A T 11: 60,508,202 I2787F probably damaging Het
Ndst1 A G 18: 60,713,205 C11R possibly damaging Het
Obsl1 C A 1: 75,487,656 G1669* probably null Het
Olfr477 A G 7: 107,990,398 E11G probably benign Het
Olfr784 A T 10: 129,387,783 D50V probably damaging Het
Olfr873 T C 9: 20,300,838 Y214H probably benign Het
Pafah2 T A 4: 134,404,157 I52N probably damaging Het
Pcsk6 A T 7: 66,043,535 I693F possibly damaging Het
Pde4c G T 8: 70,746,613 R228L probably benign Het
Pdzd8 T C 19: 59,300,472 N832S probably benign Het
Plbd1 T A 6: 136,613,816 M451L probably benign Het
Pramef17 G T 4: 143,993,281 D171E probably benign Het
Prom1 T C 5: 44,037,623 D260G probably damaging Het
Ranbp17 A G 11: 33,266,310 S813P probably damaging Het
Scn10a T C 9: 119,691,478 I119V probably benign Het
Sh3pxd2b A G 11: 32,415,967 T353A probably damaging Het
Shq1 A T 6: 100,669,698 probably null Het
Slc22a28 T A 19: 8,071,858 H342L possibly damaging Het
Slco2b1 C T 7: 99,664,907 E9K probably null Het
Specc1l T C 10: 75,246,284 F505L probably damaging Het
Sptan1 G T 2: 29,980,203 probably null Het
St6gal2 A G 17: 55,490,931 probably benign Het
Taok2 T C 7: 126,880,141 I73V probably benign Het
Tax1bp1 C T 6: 52,744,244 T478I probably benign Het
Tbc1d4 A T 14: 101,507,106 N361K probably damaging Het
Tph1 A T 7: 46,647,483 Y429* probably null Het
Tprkb A T 6: 85,924,421 R14W probably damaging Het
Trio A T 15: 27,753,804 probably benign Het
Ttc23 T C 7: 67,667,154 probably benign Het
Vmn1r211 T C 13: 22,852,245 Y84C probably damaging Het
Vmn2r22 C G 6: 123,637,665 G322A possibly damaging Het
Wdr74 A G 19: 8,740,412 Q330R probably benign Het
Wdtc1 C A 4: 133,297,428 S486I possibly damaging Het
Zbtb24 T C 10: 41,464,993 V673A possibly damaging Het
Zfpm2 A T 15: 41,102,481 R655S probably damaging Het
Zkscan5 A G 5: 145,220,988 N694D probably benign Het
Other mutations in Ddx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx17 APN 15 79530376 missense probably benign
IGL02904:Ddx17 APN 15 79530437 nonsense probably null
PIT4469001:Ddx17 UTSW 15 79543813 missense probably damaging 1.00
R0437:Ddx17 UTSW 15 79537471 missense probably damaging 1.00
R0507:Ddx17 UTSW 15 79537557 splice site probably benign
R1160:Ddx17 UTSW 15 79541087 missense probably damaging 1.00
R1572:Ddx17 UTSW 15 79538565 missense probably damaging 0.99
R4510:Ddx17 UTSW 15 79538592 missense probably damaging 1.00
R4511:Ddx17 UTSW 15 79538592 missense probably damaging 1.00
R4576:Ddx17 UTSW 15 79541146 missense probably benign
R6955:Ddx17 UTSW 15 79530467 missense probably benign 0.01
R7152:Ddx17 UTSW 15 79530263 missense possibly damaging 0.53
R7320:Ddx17 UTSW 15 79531904 missense probably damaging 1.00
R7805:Ddx17 UTSW 15 79537522 missense probably damaging 1.00
R7901:Ddx17 UTSW 15 79538588 missense probably damaging 1.00
R7984:Ddx17 UTSW 15 79538588 missense probably damaging 1.00
Z1177:Ddx17 UTSW 15 79530172 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCTGTGCAAACTGCTGTGACATC -3'
(R):5'- CATTTTCTTCCCACTAGGAGGCCG -3'

Sequencing Primer
(F):5'- GGCCTATCCCACTAAACTGCTG -3'
(R):5'- GCTCACGATACCGGACTACTTC -3'
Posted On2014-03-14