Incidental Mutation 'R1456:Pdzd8'
ID161837
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission 039511-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1456 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59300472 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 832 (N832S)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099274
AA Change: N832S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: N832S

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,480,920 probably null Het
4930563D23Rik T A 16: 92,320,665 Y245F probably damaging Het
4932414N04Rik A T 2: 68,716,214 E80V possibly damaging Het
Alkbh3 A G 2: 94,001,419 probably null Het
Ankar A T 1: 72,665,118 Y664N probably benign Het
Arhgap18 T C 10: 26,916,440 I629T probably benign Het
Arhgef28 C T 13: 98,075,002 E158K probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Birc6 A G 17: 74,609,290 I427V probably benign Het
Camk4 A G 18: 33,129,843 probably benign Het
Ccdc178 A T 18: 22,150,424 D16E possibly damaging Het
Cct6b G T 11: 82,753,620 probably benign Het
Ccz1 A G 5: 144,011,018 probably benign Het
Cdh23 T C 10: 60,487,120 N335S possibly damaging Het
Cemip T A 7: 83,998,510 S121C possibly damaging Het
Cers1 A G 8: 70,331,188 E262G probably damaging Het
Clec11a G T 7: 44,306,450 P58T possibly damaging Het
Clec16a T C 16: 10,691,555 I797T probably damaging Het
Col4a1 A C 8: 11,242,829 probably benign Het
Colgalt2 G A 1: 152,484,904 V231I probably damaging Het
D430041D05Rik G T 2: 104,208,083 N1580K probably damaging Het
Dcdc5 A G 2: 106,351,565 noncoding transcript Het
Ddx17 T C 15: 79,530,376 D530G probably benign Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah3 A G 7: 120,047,630 Y1059H probably damaging Het
Dtx1 C A 5: 120,710,504 probably benign Het
Egfr A G 11: 16,863,065 S182G probably benign Het
Fads1 A G 19: 10,185,752 N131S probably benign Het
Fancm C T 12: 65,118,351 A1490V possibly damaging Het
Fsd2 C A 7: 81,559,591 E168* probably null Het
Gm20388 T C 8: 122,841,948 probably benign Het
Gm9772 A T 17: 22,007,118 C62S probably damaging Het
H60c C T 10: 3,260,307 A81T possibly damaging Het
Hira T G 16: 18,925,663 S377A probably benign Het
Iffo1 T C 6: 125,145,914 S220P possibly damaging Het
Itih4 A G 14: 30,892,653 M491V probably benign Het
Khdrbs2 T C 1: 32,520,696 R102G possibly damaging Het
Klhdc7a T G 4: 139,965,524 Y704S possibly damaging Het
Klk1b21 G A 7: 44,105,499 V73I probably benign Het
Krt42 G A 11: 100,269,609 A88V probably benign Het
Krt42 C T 11: 100,269,610 A88T probably benign Het
Limk1 G T 5: 134,657,510 D580E probably benign Het
Lipk C T 19: 34,046,785 P323S probably damaging Het
Lipo5 T A 19: 33,465,873 probably benign Het
Llgl2 A G 11: 115,845,499 D166G probably benign Het
Mapk8ip3 A T 17: 24,906,949 N439K probably damaging Het
Mapkbp1 C T 2: 119,973,145 R32W probably damaging Het
Med23 T A 10: 24,903,652 probably benign Het
Mrgprb1 A T 7: 48,448,029 M45K probably damaging Het
Mroh7 G A 4: 106,695,141 probably benign Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Ms4a10 T A 19: 10,964,733 T175S possibly damaging Het
Muc3 T C 5: 137,137,951 H330R probably benign Het
Myo15 A T 11: 60,508,202 I2787F probably damaging Het
Ndst1 A G 18: 60,713,205 C11R possibly damaging Het
Obsl1 C A 1: 75,487,656 G1669* probably null Het
Olfr477 A G 7: 107,990,398 E11G probably benign Het
Olfr784 A T 10: 129,387,783 D50V probably damaging Het
Olfr873 T C 9: 20,300,838 Y214H probably benign Het
Pafah2 T A 4: 134,404,157 I52N probably damaging Het
Pcsk6 A T 7: 66,043,535 I693F possibly damaging Het
Pde4c G T 8: 70,746,613 R228L probably benign Het
Plbd1 T A 6: 136,613,816 M451L probably benign Het
Pramef17 G T 4: 143,993,281 D171E probably benign Het
Prom1 T C 5: 44,037,623 D260G probably damaging Het
Ranbp17 A G 11: 33,266,310 S813P probably damaging Het
Scn10a T C 9: 119,691,478 I119V probably benign Het
Sh3pxd2b A G 11: 32,415,967 T353A probably damaging Het
Shq1 A T 6: 100,669,698 probably null Het
Slc22a28 T A 19: 8,071,858 H342L possibly damaging Het
Slco2b1 C T 7: 99,664,907 E9K probably null Het
Specc1l T C 10: 75,246,284 F505L probably damaging Het
Sptan1 G T 2: 29,980,203 probably null Het
St6gal2 A G 17: 55,490,931 probably benign Het
Taok2 T C 7: 126,880,141 I73V probably benign Het
Tax1bp1 C T 6: 52,744,244 T478I probably benign Het
Tbc1d4 A T 14: 101,507,106 N361K probably damaging Het
Tph1 A T 7: 46,647,483 Y429* probably null Het
Tprkb A T 6: 85,924,421 R14W probably damaging Het
Trio A T 15: 27,753,804 probably benign Het
Ttc23 T C 7: 67,667,154 probably benign Het
Vmn1r211 T C 13: 22,852,245 Y84C probably damaging Het
Vmn2r22 C G 6: 123,637,665 G322A possibly damaging Het
Wdr74 A G 19: 8,740,412 Q330R probably benign Het
Wdtc1 C A 4: 133,297,428 S486I possibly damaging Het
Zbtb24 T C 10: 41,464,993 V673A possibly damaging Het
Zfpm2 A T 15: 41,102,481 R655S probably damaging Het
Zkscan5 A G 5: 145,220,988 N694D probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGCCTCTCAGTTGCTCCACAAAG -3'
(R):5'- TGTGTGTTTGACATAGAAGCCTGCC -3'

Sequencing Primer
(F):5'- TCAGTTGCTCCACAAAGAGGTG -3'
(R):5'- TGGTCACTAGAACTGCACTACG -3'
Posted On2014-03-14