Mutagenetix > Incidental Mutations

Incidental Mutation 'R1458:Gria2'

161855

Institutional Source

Beutler Lab

Gene Symbol

Gria2

Ensembl Gene

ENSMUSG00000033981

Gene Name

glutamate receptor, ionotropic, AMPA2 (alpha 2)

Synonyms

Glur2, Glur-2, GluR-B, GluA2, GluR2

MMRRC Submission

039513-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.540) question?

Stock #

R1458 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80681450-80802835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80732045 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 220 (V220E)

Ref Sequence

ENSEMBL: ENSMUSP00000141447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075316
AA Change: V220E

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: V220E

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	49	379	2.7e-58	PFAM
PBPe	415	790	3.75e-132	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107745
AA Change: V220E

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: V220E

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	47	379	4.8e-53	PFAM
PBPe	415	790	8.16e-133	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192463
AA Change: V220E

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: V220E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	47	379	1.7e-51	PFAM
PBPe	415	770	1.2e-105	SMART
Lig_chan-Glu_bd	425	490	2.2e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195062

Meta Mutation Damage Score

0.7053

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	A	G	9: 60,769,761		noncoding transcript	Het
A430110L20Rik	T	A	1: 181,227,858		noncoding transcript	Het
Abce1	T	C	8: 79,707,235	K63R	possibly damaging	Het
Acp6	A	G	3: 97,173,788		probably benign	Het
Adamts13	T	A	2: 26,988,354	L579Q	probably damaging	Het
Adamtsl3	T	A	7: 82,523,320	M497K	probably damaging	Het
Adgrb2	T	A	4: 130,014,591	M1042K	possibly damaging	Het
Akap12	A	T	10: 4,353,693	S168C	probably damaging	Het
Akap3	A	T	6: 126,865,554	M379L	probably damaging	Het
Aldh6a1	C	T	12: 84,439,663	M135I	probably null	Het
Arhgef12	A	G	9: 42,988,998	S860P	probably damaging	Het
Atp11b	A	C	3: 35,789,558	T185P	probably damaging	Het
Bcas1	T	C	2: 170,387,951	D243G	probably damaging	Het
Cdhr2	T	A	13: 54,717,872	S228T	probably damaging	Het
Cic	T	C	7: 25,279,737		probably benign	Het
Cmya5	T	A	13: 93,065,327	I3376L	probably benign	Het
Ctrc	C	A	4: 141,846,224		probably null	Het
D230025D16Rik	T	C	8: 105,246,556		probably null	Het
Dchs1	G	T	7: 105,755,244	P2697Q	probably damaging	Het
Dmbt1	A	G	7: 131,044,487		probably benign	Het
Drd2	G	A	9: 49,402,212	R227H	probably damaging	Het
Dscc1	C	A	15: 55,086,764	C195F	probably damaging	Het
Dzip1	T	A	14: 118,922,713	M28L	probably benign	Het
Edar	A	T	10: 58,607,366	S313T	probably benign	Het
Eef1e1	C	A	13: 38,656,123	A69S	probably damaging	Het
Fbn1	A	G	2: 125,301,929	V2760A	probably benign	Het
Fez1	GACAAACA	GACA	9: 36,870,549		probably null	Het
Fgl1	C	G	8: 41,210,459	A11P	possibly damaging	Het
Fras1	T	C	5: 96,600,733	V689A	probably benign	Het
Fry	T	A	5: 150,380,859	D571E	probably damaging	Het
Gm11232	T	A	4: 71,757,213	R104*	probably null	Het
Gm1527	A	G	3: 28,918,050	I439V	possibly damaging	Het
Gm4922	C	A	10: 18,783,892	G361*	probably null	Het
Gm7052	T	A	17: 22,040,466		probably benign	Het
Gm7534	T	C	4: 134,196,833	D467G	probably benign	Het
Gpatch8	A	T	11: 102,481,229	S494R	unknown	Het
Grik4	G	A	9: 42,521,122	H860Y	probably benign	Het
Gtpbp1	A	C	15: 79,707,729	S93R	probably damaging	Het
Gucy2g	C	A	19: 55,215,036		probably benign	Het
Hist1h2ae	C	A	13: 23,571,047		probably benign	Het
Hmcn1	G	A	1: 150,609,700	R4384C	probably damaging	Het
Hspa12b	G	C	2: 131,145,192	A678P	probably damaging	Het
Igsf21	T	A	4: 140,028,124	N407Y	probably damaging	Het
Insig2	A	G	1: 121,307,156	Y174H	probably benign	Het
Itpr3	T	A	17: 27,118,372	M2413K	probably benign	Het
Kalrn	A	T	16: 34,174,487	I1322N	probably damaging	Het
Klk1b24	T	A	7: 44,191,466	M106K	possibly damaging	Het
Krt81	G	T	15: 101,460,317	Q352K	probably benign	Het
Lca5l	A	T	16: 96,159,859	S468T	possibly damaging	Het
Lvrn	T	C	18: 46,882,385		probably benign	Het
Mcpt1	T	A	14: 56,019,164		probably benign	Het
Med13l	T	C	5: 118,738,459	M900T	probably benign	Het
Med16	A	G	10: 79,907,478		probably benign	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mep1a	T	C	17: 43,491,672	H154R	probably damaging	Het
Mrc2	A	T	11: 105,337,772	D659V	probably benign	Het
Mroh8	T	A	2: 157,221,304	E799V	probably damaging	Het
Mrpl21	A	G	19: 3,284,808	Y50C	possibly damaging	Het
Msl1	A	G	11: 98,803,982		probably benign	Het
Myo1a	C	A	10: 127,719,937	Q932K	probably benign	Het
Nav3	A	C	10: 109,720,044	S1675R	probably damaging	Het
Neurl2	A	G	2: 164,832,746	V232A	possibly damaging	Het
Nfatc1	T	A	18: 80,665,267		probably benign	Het
Odf3l2	A	T	10: 79,645,558		probably benign	Het
Olfr1362	C	T	13: 21,611,822	C49Y	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,676	E11V	probably null	Het
P4hb	A	G	11: 120,562,555		probably benign	Het
Papss1	T	G	3: 131,605,854	I281S	probably damaging	Het
Pde10a	A	T	17: 8,964,708	D832V	probably damaging	Het
Pfkfb2	A	T	1: 130,708,190	Y35N	possibly damaging	Het
Phf20l1	T	A	15: 66,604,813	F253Y	probably damaging	Het
Pkhd1l1	G	A	15: 44,516,115	V1046I	probably benign	Het
Plin3	C	T	17: 56,284,337	A148T	probably benign	Het
Ppp1r8	T	C	4: 132,840,631		probably benign	Het
Ppp2r3a	A	G	9: 101,211,312	L604P	probably damaging	Het
Prdm5	T	C	6: 65,883,601	V239A	probably damaging	Het
Prickle1	A	G	15: 93,500,638	S770P	probably damaging	Het
Prl2c5	T	A	13: 13,190,725	I155N	probably benign	Het
Prom1	T	C	5: 44,032,932		probably benign	Het
Psg25	C	T	7: 18,529,587	G104R	probably damaging	Het
Rbm19	T	C	5: 120,144,029	V817A	probably benign	Het
Ryr2	T	A	13: 11,727,022	Y2091F	probably damaging	Het
Slc16a4	A	G	3: 107,300,932	T253A	probably benign	Het
Smg7	A	T	1: 152,855,843		probably null	Het
Spink5	C	A	18: 44,007,719	H662N	probably benign	Het
Taf2	A	T	15: 55,059,915	M322K	probably damaging	Het
Tmc2	T	C	2: 130,248,762	F676S	probably damaging	Het
Tmem177	A	G	1: 119,910,185	S255P	possibly damaging	Het
Trim46	A	T	3: 89,235,068		probably null	Het
Tubb1	T	A	2: 174,450,803		probably null	Het
Upf1	T	C	8: 70,344,254	T110A	probably benign	Het
Vmn2r9	T	A	5: 108,848,984	I140L	probably benign	Het
Zfp638	T	A	6: 83,944,656	H588Q	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Gria2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Gria2	APN	3	80710790	missense	probably benign	0.12
IGL00832:Gria2	APN	3	80707251	missense	probably damaging	1.00
IGL01086:Gria2	APN	3	80692381	missense	probably damaging	1.00
IGL01409:Gria2	APN	3	80707697	critical splice donor site	probably null
IGL01924:Gria2	APN	3	80710331	missense	probably benign	0.13
IGL01999:Gria2	APN	3	80732091	missense	probably damaging	1.00
IGL02355:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02362:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02389:Gria2	APN	3	80709422	missense	probably benign	0.14
IGL02444:Gria2	APN	3	80702553	missense	possibly damaging	0.65
IGL02532:Gria2	APN	3	80706999	missense	probably damaging	1.00
IGL02991:Gria2	UTSW	3	80707809	nonsense	probably null
R0015:Gria2	UTSW	3	80707767	missense	probably damaging	1.00
R0148:Gria2	UTSW	3	80707731	missense	probably damaging	1.00
R0201:Gria2	UTSW	3	80707838	missense	probably damaging	1.00
R0411:Gria2	UTSW	3	80710858	splice site	probably benign
R0551:Gria2	UTSW	3	80732026	splice site	probably benign
R0655:Gria2	UTSW	3	80732070	nonsense	probably null
R0866:Gria2	UTSW	3	80722024	splice site	probably benign
R1393:Gria2	UTSW	3	80707098	missense	probably damaging	1.00
R1563:Gria2	UTSW	3	80691397	missense	probably damaging	0.96
R1771:Gria2	UTSW	3	80692301	nonsense	probably null
R1775:Gria2	UTSW	3	80691338	missense	probably benign	0.09
R1902:Gria2	UTSW	3	80722108	missense	probably damaging	0.98
R1993:Gria2	UTSW	3	80802357	missense	probably benign
R1994:Gria2	UTSW	3	80802357	missense	probably benign
R1995:Gria2	UTSW	3	80802357	missense	probably benign
R2001:Gria2	UTSW	3	80710805	missense	probably benign	0.28
R2389:Gria2	UTSW	3	80702625	missense	probably damaging	1.00
R2520:Gria2	UTSW	3	80706962	missense	probably damaging	1.00
R2679:Gria2	UTSW	3	80740953	splice site	probably benign
R2865:Gria2	UTSW	3	80732085	missense	probably benign	0.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R3716:Gria2	UTSW	3	80741004	missense	possibly damaging	0.77
R3967:Gria2	UTSW	3	80710777	missense	possibly damaging	0.95
R4285:Gria2	UTSW	3	80707662	intron	probably benign
R4611:Gria2	UTSW	3	80692492	missense	probably damaging	0.99
R4612:Gria2	UTSW	3	80732051	missense	probably damaging	1.00
R4616:Gria2	UTSW	3	80706897	missense	probably damaging	1.00
R4706:Gria2	UTSW	3	80740990	missense	probably benign
R4996:Gria2	UTSW	3	80707141	missense	probably damaging	0.99
R5502:Gria2	UTSW	3	80706945	missense	probably damaging	1.00
R5930:Gria2	UTSW	3	80707249	missense	possibly damaging	0.91
R6142:Gria2	UTSW	3	80801717	missense	probably benign	0.13
R6233:Gria2	UTSW	3	80707203	missense	probably damaging	0.99
R6317:Gria2	UTSW	3	80741004	missense	possibly damaging	0.79
R6453:Gria2	UTSW	3	80740974	missense	possibly damaging	0.93
R6526:Gria2	UTSW	3	80692469	missense	probably damaging	1.00
R6545:Gria2	UTSW	3	80741144	missense	probably damaging	0.99
R6574:Gria2	UTSW	3	80689296	missense	probably damaging	0.99
R6720:Gria2	UTSW	3	80802304	missense	probably benign	0.37
R7009:Gria2	UTSW	3	80706972	missense	probably damaging	1.00
R7049:Gria2	UTSW	3	80689327	missense	probably damaging	0.99
R7191:Gria2	UTSW	3	80732085	missense	probably benign	0.24
R7225:Gria2	UTSW	3	80802631	unclassified	probably benign
R7374:Gria2	UTSW	3	80741076	missense	probably benign
R7837:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R8034:Gria2	UTSW	3	80801699	missense	probably damaging	1.00
R8125:Gria2	UTSW	3	80707243	missense	possibly damaging	0.88
R8189:Gria2	UTSW	3	80722182	missense	probably damaging	1.00
R8209:Gria2	UTSW	3	80709457	missense	probably benign	0.01
R8362:Gria2	UTSW	3	80707890	missense	possibly damaging	0.82
R8481:Gria2	UTSW	3	80801691	missense	possibly damaging	0.95
R8500:Gria2	UTSW	3	80692467	missense	probably damaging	0.99
R8516:Gria2	UTSW	3	80706987	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TCTGCCATTGCTTACTGAGGCTG -3'
(R):5'- CTATGAGGTGGACATGCTTGGGAC -3'

Sequencing Primer
(F):5'- CTTACTGAGGCTGGGGATAATTC -3'
(R):5'- AACACTGCAAGCTGTGCTG -3'

Posted On

2014-03-14