Incidental Mutation 'R1458:Phaf1'
ID 161885
Institutional Source Beutler Lab
Gene Symbol Phaf1
Ensembl Gene ENSMUSG00000031889
Gene Name phagosome assembly factor 1
Synonyms D230025D16Rik, Mytho, Lin10
MMRRC Submission 039513-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R1458 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105951779-105979685 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 105973188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034361] [ENSMUST00000124113] [ENSMUST00000141957]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000034361
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133035
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156561
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,677,043 (GRCm39) noncoding transcript Het
A430110L20Rik T A 1: 181,055,423 (GRCm39) noncoding transcript Het
Abce1 T C 8: 80,433,864 (GRCm39) K63R possibly damaging Het
Acp6 A G 3: 97,081,104 (GRCm39) probably benign Het
Adamts13 T A 2: 26,878,366 (GRCm39) L579Q probably damaging Het
Adamtsl3 T A 7: 82,172,528 (GRCm39) M497K probably damaging Het
Adgrb2 T A 4: 129,908,384 (GRCm39) M1042K possibly damaging Het
Akap12 A T 10: 4,303,693 (GRCm39) S168C probably damaging Het
Akap3 A T 6: 126,842,517 (GRCm39) M379L probably damaging Het
Aldh6a1 C T 12: 84,486,437 (GRCm39) M135I probably null Het
Arhgef12 A G 9: 42,900,294 (GRCm39) S860P probably damaging Het
Atp11b A C 3: 35,843,707 (GRCm39) T185P probably damaging Het
Bcas1 T C 2: 170,229,871 (GRCm39) D243G probably damaging Het
Cdhr2 T A 13: 54,865,685 (GRCm39) S228T probably damaging Het
Cic T C 7: 24,979,162 (GRCm39) probably benign Het
Cimap1d A T 10: 79,481,392 (GRCm39) probably benign Het
Cmya5 T A 13: 93,201,835 (GRCm39) I3376L probably benign Het
Ctrc C A 4: 141,573,535 (GRCm39) probably null Het
Dchs1 G T 7: 105,404,451 (GRCm39) P2697Q probably damaging Het
Dmbt1 A G 7: 130,646,217 (GRCm39) probably benign Het
Drd2 G A 9: 49,313,512 (GRCm39) R227H probably damaging Het
Dscc1 C A 15: 54,950,160 (GRCm39) C195F probably damaging Het
Dzip1 T A 14: 119,160,125 (GRCm39) M28L probably benign Het
Edar A T 10: 58,443,188 (GRCm39) S313T probably benign Het
Eef1e1 C A 13: 38,840,099 (GRCm39) A69S probably damaging Het
Fbn1 A G 2: 125,143,849 (GRCm39) V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,781,845 (GRCm39) probably null Het
Fgl1 C G 8: 41,663,496 (GRCm39) A11P possibly damaging Het
Fras1 T C 5: 96,748,592 (GRCm39) V689A probably benign Het
Fry T A 5: 150,304,324 (GRCm39) D571E probably damaging Het
Gm11232 T A 4: 71,675,450 (GRCm39) R104* probably null Het
Gm1527 A G 3: 28,972,199 (GRCm39) I439V possibly damaging Het
Gm4922 C A 10: 18,659,640 (GRCm39) G361* probably null Het
Gm7052 T A 17: 22,259,447 (GRCm39) probably benign Het
Gpatch8 A T 11: 102,372,055 (GRCm39) S494R unknown Het
Gria2 A T 3: 80,639,352 (GRCm39) V220E possibly damaging Het
Grik4 G A 9: 42,432,418 (GRCm39) H860Y probably benign Het
Gtpbp1 A C 15: 79,591,930 (GRCm39) S93R probably damaging Het
Gucy2g C A 19: 55,203,468 (GRCm39) probably benign Het
H2ac8 C A 13: 23,755,221 (GRCm39) probably benign Het
Hmcn1 G A 1: 150,485,451 (GRCm39) R4384C probably damaging Het
Hspa12b G C 2: 130,987,112 (GRCm39) A678P probably damaging Het
Igsf21 T A 4: 139,755,435 (GRCm39) N407Y probably damaging Het
Insig2 A G 1: 121,234,885 (GRCm39) Y174H probably benign Het
Itpr3 T A 17: 27,337,346 (GRCm39) M2413K probably benign Het
Kalrn A T 16: 33,994,857 (GRCm39) I1322N probably damaging Het
Klk1b24 T A 7: 43,840,890 (GRCm39) M106K possibly damaging Het
Krt81 G T 15: 101,358,198 (GRCm39) Q352K probably benign Het
Lca5l A T 16: 95,961,059 (GRCm39) S468T possibly damaging Het
Lvrn T C 18: 47,015,452 (GRCm39) probably benign Het
Mcpt1 T A 14: 56,256,621 (GRCm39) probably benign Het
Med13l T C 5: 118,876,524 (GRCm39) M900T probably benign Het
Med16 A G 10: 79,743,312 (GRCm39) probably benign Het
Megf6 G T 4: 154,261,578 (GRCm39) V68L probably benign Het
Mep1a T C 17: 43,802,563 (GRCm39) H154R probably damaging Het
Mrc2 A T 11: 105,228,598 (GRCm39) D659V probably benign Het
Mroh8 T A 2: 157,063,224 (GRCm39) E799V probably damaging Het
Mrpl21 A G 19: 3,334,808 (GRCm39) Y50C possibly damaging Het
Msl1 A G 11: 98,694,808 (GRCm39) probably benign Het
Myo1a C A 10: 127,555,806 (GRCm39) Q932K probably benign Het
Nav3 A C 10: 109,555,905 (GRCm39) S1675R probably damaging Het
Neurl2 A G 2: 164,674,666 (GRCm39) V232A possibly damaging Het
Nfatc1 T A 18: 80,708,482 (GRCm39) probably benign Het
Or2w4 C T 13: 21,795,992 (GRCm39) C49Y probably benign Het
Or5k8 T A 16: 58,645,039 (GRCm39) E11V probably null Het
P4hb A G 11: 120,453,381 (GRCm39) probably benign Het
Papss1 T G 3: 131,311,615 (GRCm39) I281S probably damaging Het
Pde10a A T 17: 9,183,540 (GRCm39) D832V probably damaging Het
Pfkfb2 A T 1: 130,635,927 (GRCm39) Y35N possibly damaging Het
Phf20l1 T A 15: 66,476,662 (GRCm39) F253Y probably damaging Het
Pkhd1l1 G A 15: 44,379,511 (GRCm39) V1046I probably benign Het
Plin3 C T 17: 56,591,337 (GRCm39) A148T probably benign Het
Ppp1r8 T C 4: 132,567,942 (GRCm39) probably benign Het
Ppp2r3d A G 9: 101,088,511 (GRCm39) L604P probably damaging Het
Prdm5 T C 6: 65,860,585 (GRCm39) V239A probably damaging Het
Prickle1 A G 15: 93,398,519 (GRCm39) S770P probably damaging Het
Prl2c5 T A 13: 13,365,310 (GRCm39) I155N probably benign Het
Prom1 T C 5: 44,190,274 (GRCm39) probably benign Het
Psg25 C T 7: 18,263,512 (GRCm39) G104R probably damaging Het
Rbm19 T C 5: 120,282,094 (GRCm39) V817A probably benign Het
Ryr2 T A 13: 11,741,908 (GRCm39) Y2091F probably damaging Het
Slc16a4 A G 3: 107,208,248 (GRCm39) T253A probably benign Het
Smg7 A T 1: 152,731,594 (GRCm39) probably null Het
Spink5 C A 18: 44,140,786 (GRCm39) H662N probably benign Het
Taf2 A T 15: 54,923,311 (GRCm39) M322K probably damaging Het
Tmc2 T C 2: 130,090,682 (GRCm39) F676S probably damaging Het
Tmem177 A G 1: 119,837,915 (GRCm39) S255P possibly damaging Het
Trim46 A T 3: 89,142,375 (GRCm39) probably null Het
Tubb1 T A 2: 174,292,596 (GRCm39) probably null Het
Upf1 T C 8: 70,796,904 (GRCm39) T110A probably benign Het
Vmn2r9 T A 5: 108,996,850 (GRCm39) I140L probably benign Het
Zfp638 T A 6: 83,921,638 (GRCm39) H588Q probably damaging Het
Zfp780b T A 7: 27,664,252 (GRCm39) N101I probably damaging Het
Zpld2 T C 4: 133,924,144 (GRCm39) D467G probably benign Het
Other mutations in Phaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Phaf1 APN 8 105,966,633 (GRCm39) missense probably damaging 0.99
IGL02058:Phaf1 APN 8 105,966,341 (GRCm39) missense probably damaging 1.00
IGL02162:Phaf1 APN 8 105,966,605 (GRCm39) splice site probably benign
IGL02264:Phaf1 APN 8 105,961,178 (GRCm39) missense possibly damaging 0.67
IGL02512:Phaf1 APN 8 105,961,110 (GRCm39) splice site probably benign
FR4340:Phaf1 UTSW 8 105,967,730 (GRCm39) missense probably benign
FR4342:Phaf1 UTSW 8 105,967,730 (GRCm39) missense probably benign
FR4589:Phaf1 UTSW 8 105,967,730 (GRCm39) missense probably benign
R0564:Phaf1 UTSW 8 105,966,603 (GRCm39) splice site probably benign
R1705:Phaf1 UTSW 8 105,965,104 (GRCm39) splice site probably benign
R1860:Phaf1 UTSW 8 105,966,703 (GRCm39) missense probably null 1.00
R1861:Phaf1 UTSW 8 105,966,703 (GRCm39) missense probably null 1.00
R1893:Phaf1 UTSW 8 105,973,133 (GRCm39) missense probably damaging 1.00
R1969:Phaf1 UTSW 8 105,973,132 (GRCm39) missense possibly damaging 0.81
R2246:Phaf1 UTSW 8 105,973,132 (GRCm39) missense possibly damaging 0.81
R3914:Phaf1 UTSW 8 105,966,615 (GRCm39) missense probably benign 0.00
R4175:Phaf1 UTSW 8 105,967,763 (GRCm39) missense probably benign 0.09
R4176:Phaf1 UTSW 8 105,967,763 (GRCm39) missense probably benign 0.09
R4602:Phaf1 UTSW 8 105,973,520 (GRCm39) missense possibly damaging 0.72
R5965:Phaf1 UTSW 8 105,961,171 (GRCm39) missense probably damaging 1.00
R7717:Phaf1 UTSW 8 105,978,236 (GRCm39) missense probably benign 0.12
R7787:Phaf1 UTSW 8 105,957,820 (GRCm39) missense probably damaging 1.00
R7881:Phaf1 UTSW 8 105,976,084 (GRCm39) missense probably benign 0.21
R8168:Phaf1 UTSW 8 105,975,401 (GRCm39) missense probably benign 0.02
R8949:Phaf1 UTSW 8 105,976,075 (GRCm39) missense probably benign
R9183:Phaf1 UTSW 8 105,957,840 (GRCm39) missense probably benign 0.01
Z1088:Phaf1 UTSW 8 105,957,804 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGTATGCAACAGCAGGCTC -3'
(R):5'- GTGTGGACACATCTCCAGGTTACAG -3'

Sequencing Primer
(F):5'- TGGGTTACAGTGCCTCCAG -3'
(R):5'- CTCCAGGTTACAGAGATGGTGC -3'
Posted On 2014-03-14