Mutagenetix > Incidental Mutation

Incidental Mutation 'R1458:Arhgef12'

161888

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

039513-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R1458 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42988998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 860 (S860P)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

AlphaFold

Q8R4H2

Predicted Effect

probably damaging
Transcript: ENSMUST00000072767
AA Change: S859P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: S859P

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165665
AA Change: S860P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: S860P

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Meta Mutation Damage Score

0.2160

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	A	G	9: 60,769,761		noncoding transcript	Het
A430110L20Rik	T	A	1: 181,227,858		noncoding transcript	Het
Abce1	T	C	8: 79,707,235	K63R	possibly damaging	Het
Acp6	A	G	3: 97,173,788		probably benign	Het
Adamts13	T	A	2: 26,988,354	L579Q	probably damaging	Het
Adamtsl3	T	A	7: 82,523,320	M497K	probably damaging	Het
Adgrb2	T	A	4: 130,014,591	M1042K	possibly damaging	Het
Akap12	A	T	10: 4,353,693	S168C	probably damaging	Het
Akap3	A	T	6: 126,865,554	M379L	probably damaging	Het
Aldh6a1	C	T	12: 84,439,663	M135I	probably null	Het
Atp11b	A	C	3: 35,789,558	T185P	probably damaging	Het
Bcas1	T	C	2: 170,387,951	D243G	probably damaging	Het
Cdhr2	T	A	13: 54,717,872	S228T	probably damaging	Het
Cic	T	C	7: 25,279,737		probably benign	Het
Cmya5	T	A	13: 93,065,327	I3376L	probably benign	Het
Ctrc	C	A	4: 141,846,224		probably null	Het
D230025D16Rik	T	C	8: 105,246,556		probably null	Het
Dchs1	G	T	7: 105,755,244	P2697Q	probably damaging	Het
Dmbt1	A	G	7: 131,044,487		probably benign	Het
Drd2	G	A	9: 49,402,212	R227H	probably damaging	Het
Dscc1	C	A	15: 55,086,764	C195F	probably damaging	Het
Dzip1	T	A	14: 118,922,713	M28L	probably benign	Het
Edar	A	T	10: 58,607,366	S313T	probably benign	Het
Eef1e1	C	A	13: 38,656,123	A69S	probably damaging	Het
Fbn1	A	G	2: 125,301,929	V2760A	probably benign	Het
Fez1	GACAAACA	GACA	9: 36,870,549		probably null	Het
Fgl1	C	G	8: 41,210,459	A11P	possibly damaging	Het
Fras1	T	C	5: 96,600,733	V689A	probably benign	Het
Fry	T	A	5: 150,380,859	D571E	probably damaging	Het
Gm11232	T	A	4: 71,757,213	R104*	probably null	Het
Gm1527	A	G	3: 28,918,050	I439V	possibly damaging	Het
Gm4922	C	A	10: 18,783,892	G361*	probably null	Het
Gm7052	T	A	17: 22,040,466		probably benign	Het
Gm7534	T	C	4: 134,196,833	D467G	probably benign	Het
Gpatch8	A	T	11: 102,481,229	S494R	unknown	Het
Gria2	A	T	3: 80,732,045	V220E	possibly damaging	Het
Grik4	G	A	9: 42,521,122	H860Y	probably benign	Het
Gtpbp1	A	C	15: 79,707,729	S93R	probably damaging	Het
Gucy2g	C	A	19: 55,215,036		probably benign	Het
Hist1h2ae	C	A	13: 23,571,047		probably benign	Het
Hmcn1	G	A	1: 150,609,700	R4384C	probably damaging	Het
Hspa12b	G	C	2: 131,145,192	A678P	probably damaging	Het
Igsf21	T	A	4: 140,028,124	N407Y	probably damaging	Het
Insig2	A	G	1: 121,307,156	Y174H	probably benign	Het
Itpr3	T	A	17: 27,118,372	M2413K	probably benign	Het
Kalrn	A	T	16: 34,174,487	I1322N	probably damaging	Het
Klk1b24	T	A	7: 44,191,466	M106K	possibly damaging	Het
Krt81	G	T	15: 101,460,317	Q352K	probably benign	Het
Lca5l	A	T	16: 96,159,859	S468T	possibly damaging	Het
Lvrn	T	C	18: 46,882,385		probably benign	Het
Mcpt1	T	A	14: 56,019,164		probably benign	Het
Med13l	T	C	5: 118,738,459	M900T	probably benign	Het
Med16	A	G	10: 79,907,478		probably benign	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mep1a	T	C	17: 43,491,672	H154R	probably damaging	Het
Mrc2	A	T	11: 105,337,772	D659V	probably benign	Het
Mroh8	T	A	2: 157,221,304	E799V	probably damaging	Het
Mrpl21	A	G	19: 3,284,808	Y50C	possibly damaging	Het
Msl1	A	G	11: 98,803,982		probably benign	Het
Myo1a	C	A	10: 127,719,937	Q932K	probably benign	Het
Nav3	A	C	10: 109,720,044	S1675R	probably damaging	Het
Neurl2	A	G	2: 164,832,746	V232A	possibly damaging	Het
Nfatc1	T	A	18: 80,665,267		probably benign	Het
Odf3l2	A	T	10: 79,645,558		probably benign	Het
Olfr1362	C	T	13: 21,611,822	C49Y	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,676	E11V	probably null	Het
P4hb	A	G	11: 120,562,555		probably benign	Het
Papss1	T	G	3: 131,605,854	I281S	probably damaging	Het
Pde10a	A	T	17: 8,964,708	D832V	probably damaging	Het
Pfkfb2	A	T	1: 130,708,190	Y35N	possibly damaging	Het
Phf20l1	T	A	15: 66,604,813	F253Y	probably damaging	Het
Pkhd1l1	G	A	15: 44,516,115	V1046I	probably benign	Het
Plin3	C	T	17: 56,284,337	A148T	probably benign	Het
Ppp1r8	T	C	4: 132,840,631		probably benign	Het
Ppp2r3a	A	G	9: 101,211,312	L604P	probably damaging	Het
Prdm5	T	C	6: 65,883,601	V239A	probably damaging	Het
Prickle1	A	G	15: 93,500,638	S770P	probably damaging	Het
Prl2c5	T	A	13: 13,190,725	I155N	probably benign	Het
Prom1	T	C	5: 44,032,932		probably benign	Het
Psg25	C	T	7: 18,529,587	G104R	probably damaging	Het
Rbm19	T	C	5: 120,144,029	V817A	probably benign	Het
Ryr2	T	A	13: 11,727,022	Y2091F	probably damaging	Het
Slc16a4	A	G	3: 107,300,932	T253A	probably benign	Het
Smg7	A	T	1: 152,855,843		probably null	Het
Spink5	C	A	18: 44,007,719	H662N	probably benign	Het
Taf2	A	T	15: 55,059,915	M322K	probably damaging	Het
Tmc2	T	C	2: 130,248,762	F676S	probably damaging	Het
Tmem177	A	G	1: 119,910,185	S255P	possibly damaging	Het
Trim46	A	T	3: 89,235,068		probably null	Het
Tubb1	T	A	2: 174,450,803		probably null	Het
Upf1	T	C	8: 70,344,254	T110A	probably benign	Het
Vmn2r9	T	A	5: 108,848,984	I140L	probably benign	Het
Zfp638	T	A	6: 83,944,656	H588Q	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43005594	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42970990	splice site	probably null
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43001006	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5176:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43040552	missense	probably damaging	1.00
R7658:Arhgef12	UTSW	9	42992536	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
R9116:Arhgef12	UTSW	9	42981945	splice site	probably benign
R9127:Arhgef12	UTSW	9	42974574	missense	possibly damaging	0.94
R9602:Arhgef12	UTSW	9	42984380	missense	probably damaging	1.00
R9665:Arhgef12	UTSW	9	43018354	missense	possibly damaging	0.89
R9733:Arhgef12	UTSW	9	42989998	nonsense	probably null
R9735:Arhgef12	UTSW	9	42971103	nonsense	probably null
R9760:Arhgef12	UTSW	9	42992022	missense	probably damaging	1.00
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00
Z1186:Arhgef12	UTSW	9	43000015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGATGGAGCACTGAGTCTGATTGC -3'
(R):5'- GAGTCTTTCTGAGCTGGGCTACAC -3'

Sequencing Primer
(F):5'- CACTGAGTCTGATTGCATACTG -3'
(R):5'- CTGATTTGTACTACCAGTAGTTCGAT -3'

Posted On

2014-03-14