Incidental Mutation 'R1458:Phf20l1'
ID 161916
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene Name PHD finger protein 20-like 1
Synonyms E130113K22Rik, CGI-72
MMRRC Submission 039513-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.211) question?
Stock # R1458 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 66449409-66519825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66476662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 253 (F253Y)
Ref Sequence ENSEMBL: ENSMUSP00000155538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]
AlphaFold Q8CCJ9
Predicted Effect probably damaging
Transcript: ENSMUST00000048188
AA Change: F253Y

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: F253Y

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: F252Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229576
AA Change: F253Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230584
Predicted Effect probably damaging
Transcript: ENSMUST00000230882
AA Change: F252Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000230948
AA Change: F226Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230915
Meta Mutation Damage Score 0.0851 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,677,043 (GRCm39) noncoding transcript Het
A430110L20Rik T A 1: 181,055,423 (GRCm39) noncoding transcript Het
Abce1 T C 8: 80,433,864 (GRCm39) K63R possibly damaging Het
Acp6 A G 3: 97,081,104 (GRCm39) probably benign Het
Adamts13 T A 2: 26,878,366 (GRCm39) L579Q probably damaging Het
Adamtsl3 T A 7: 82,172,528 (GRCm39) M497K probably damaging Het
Adgrb2 T A 4: 129,908,384 (GRCm39) M1042K possibly damaging Het
Akap12 A T 10: 4,303,693 (GRCm39) S168C probably damaging Het
Akap3 A T 6: 126,842,517 (GRCm39) M379L probably damaging Het
Aldh6a1 C T 12: 84,486,437 (GRCm39) M135I probably null Het
Arhgef12 A G 9: 42,900,294 (GRCm39) S860P probably damaging Het
Atp11b A C 3: 35,843,707 (GRCm39) T185P probably damaging Het
Bcas1 T C 2: 170,229,871 (GRCm39) D243G probably damaging Het
Cdhr2 T A 13: 54,865,685 (GRCm39) S228T probably damaging Het
Cic T C 7: 24,979,162 (GRCm39) probably benign Het
Cimap1d A T 10: 79,481,392 (GRCm39) probably benign Het
Cmya5 T A 13: 93,201,835 (GRCm39) I3376L probably benign Het
Ctrc C A 4: 141,573,535 (GRCm39) probably null Het
Dchs1 G T 7: 105,404,451 (GRCm39) P2697Q probably damaging Het
Dmbt1 A G 7: 130,646,217 (GRCm39) probably benign Het
Drd2 G A 9: 49,313,512 (GRCm39) R227H probably damaging Het
Dscc1 C A 15: 54,950,160 (GRCm39) C195F probably damaging Het
Dzip1 T A 14: 119,160,125 (GRCm39) M28L probably benign Het
Edar A T 10: 58,443,188 (GRCm39) S313T probably benign Het
Eef1e1 C A 13: 38,840,099 (GRCm39) A69S probably damaging Het
Fbn1 A G 2: 125,143,849 (GRCm39) V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,781,845 (GRCm39) probably null Het
Fgl1 C G 8: 41,663,496 (GRCm39) A11P possibly damaging Het
Fras1 T C 5: 96,748,592 (GRCm39) V689A probably benign Het
Fry T A 5: 150,304,324 (GRCm39) D571E probably damaging Het
Gm11232 T A 4: 71,675,450 (GRCm39) R104* probably null Het
Gm1527 A G 3: 28,972,199 (GRCm39) I439V possibly damaging Het
Gm4922 C A 10: 18,659,640 (GRCm39) G361* probably null Het
Gm7052 T A 17: 22,259,447 (GRCm39) probably benign Het
Gpatch8 A T 11: 102,372,055 (GRCm39) S494R unknown Het
Gria2 A T 3: 80,639,352 (GRCm39) V220E possibly damaging Het
Grik4 G A 9: 42,432,418 (GRCm39) H860Y probably benign Het
Gtpbp1 A C 15: 79,591,930 (GRCm39) S93R probably damaging Het
Gucy2g C A 19: 55,203,468 (GRCm39) probably benign Het
H2ac8 C A 13: 23,755,221 (GRCm39) probably benign Het
Hmcn1 G A 1: 150,485,451 (GRCm39) R4384C probably damaging Het
Hspa12b G C 2: 130,987,112 (GRCm39) A678P probably damaging Het
Igsf21 T A 4: 139,755,435 (GRCm39) N407Y probably damaging Het
Insig2 A G 1: 121,234,885 (GRCm39) Y174H probably benign Het
Itpr3 T A 17: 27,337,346 (GRCm39) M2413K probably benign Het
Kalrn A T 16: 33,994,857 (GRCm39) I1322N probably damaging Het
Klk1b24 T A 7: 43,840,890 (GRCm39) M106K possibly damaging Het
Krt81 G T 15: 101,358,198 (GRCm39) Q352K probably benign Het
Lca5l A T 16: 95,961,059 (GRCm39) S468T possibly damaging Het
Lvrn T C 18: 47,015,452 (GRCm39) probably benign Het
Mcpt1 T A 14: 56,256,621 (GRCm39) probably benign Het
Med13l T C 5: 118,876,524 (GRCm39) M900T probably benign Het
Med16 A G 10: 79,743,312 (GRCm39) probably benign Het
Megf6 G T 4: 154,261,578 (GRCm39) V68L probably benign Het
Mep1a T C 17: 43,802,563 (GRCm39) H154R probably damaging Het
Mrc2 A T 11: 105,228,598 (GRCm39) D659V probably benign Het
Mroh8 T A 2: 157,063,224 (GRCm39) E799V probably damaging Het
Mrpl21 A G 19: 3,334,808 (GRCm39) Y50C possibly damaging Het
Msl1 A G 11: 98,694,808 (GRCm39) probably benign Het
Myo1a C A 10: 127,555,806 (GRCm39) Q932K probably benign Het
Nav3 A C 10: 109,555,905 (GRCm39) S1675R probably damaging Het
Neurl2 A G 2: 164,674,666 (GRCm39) V232A possibly damaging Het
Nfatc1 T A 18: 80,708,482 (GRCm39) probably benign Het
Or2w4 C T 13: 21,795,992 (GRCm39) C49Y probably benign Het
Or5k8 T A 16: 58,645,039 (GRCm39) E11V probably null Het
P4hb A G 11: 120,453,381 (GRCm39) probably benign Het
Papss1 T G 3: 131,311,615 (GRCm39) I281S probably damaging Het
Pde10a A T 17: 9,183,540 (GRCm39) D832V probably damaging Het
Pfkfb2 A T 1: 130,635,927 (GRCm39) Y35N possibly damaging Het
Phaf1 T C 8: 105,973,188 (GRCm39) probably null Het
Pkhd1l1 G A 15: 44,379,511 (GRCm39) V1046I probably benign Het
Plin3 C T 17: 56,591,337 (GRCm39) A148T probably benign Het
Ppp1r8 T C 4: 132,567,942 (GRCm39) probably benign Het
Ppp2r3d A G 9: 101,088,511 (GRCm39) L604P probably damaging Het
Prdm5 T C 6: 65,860,585 (GRCm39) V239A probably damaging Het
Prickle1 A G 15: 93,398,519 (GRCm39) S770P probably damaging Het
Prl2c5 T A 13: 13,365,310 (GRCm39) I155N probably benign Het
Prom1 T C 5: 44,190,274 (GRCm39) probably benign Het
Psg25 C T 7: 18,263,512 (GRCm39) G104R probably damaging Het
Rbm19 T C 5: 120,282,094 (GRCm39) V817A probably benign Het
Ryr2 T A 13: 11,741,908 (GRCm39) Y2091F probably damaging Het
Slc16a4 A G 3: 107,208,248 (GRCm39) T253A probably benign Het
Smg7 A T 1: 152,731,594 (GRCm39) probably null Het
Spink5 C A 18: 44,140,786 (GRCm39) H662N probably benign Het
Taf2 A T 15: 54,923,311 (GRCm39) M322K probably damaging Het
Tmc2 T C 2: 130,090,682 (GRCm39) F676S probably damaging Het
Tmem177 A G 1: 119,837,915 (GRCm39) S255P possibly damaging Het
Trim46 A T 3: 89,142,375 (GRCm39) probably null Het
Tubb1 T A 2: 174,292,596 (GRCm39) probably null Het
Upf1 T C 8: 70,796,904 (GRCm39) T110A probably benign Het
Vmn2r9 T A 5: 108,996,850 (GRCm39) I140L probably benign Het
Zfp638 T A 6: 83,921,638 (GRCm39) H588Q probably damaging Het
Zfp780b T A 7: 27,664,252 (GRCm39) N101I probably damaging Het
Zpld2 T C 4: 133,924,144 (GRCm39) D467G probably benign Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66,500,884 (GRCm39) missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66,487,482 (GRCm39) splice site probably benign
IGL00668:Phf20l1 APN 15 66,504,698 (GRCm39) missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66,508,681 (GRCm39) missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66,513,757 (GRCm39) missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66,484,981 (GRCm39) missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66,469,540 (GRCm39) missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66,500,840 (GRCm39) missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66,511,874 (GRCm39) missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66,487,259 (GRCm39) critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66,513,650 (GRCm39) missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66,487,481 (GRCm39) splice site probably benign
IGL02656:Phf20l1 APN 15 66,501,676 (GRCm39) missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66,476,713 (GRCm39) missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66,466,829 (GRCm39) critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66,467,000 (GRCm39) missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66,466,733 (GRCm39) missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66,513,796 (GRCm39) utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66,469,252 (GRCm39) missense probably damaging 1.00
Abbreviated UTSW 15 66,504,752 (GRCm39) critical splice donor site probably null
acadia UTSW 15 66,508,669 (GRCm39) missense possibly damaging 0.85
curt UTSW 15 66,511,797 (GRCm39) missense possibly damaging 0.90
Cut UTSW 15 66,484,888 (GRCm39) nonsense probably null
shorthand UTSW 15 66,481,396 (GRCm39) missense probably damaging 1.00
slang UTSW 15 66,513,781 (GRCm39) missense probably benign 0.03
PIT4305001:Phf20l1 UTSW 15 66,484,901 (GRCm39) missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66,511,840 (GRCm39) missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66,511,840 (GRCm39) missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66,481,453 (GRCm39) missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66,466,971 (GRCm39) missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66,487,479 (GRCm39) splice site probably benign
R1619:Phf20l1 UTSW 15 66,487,108 (GRCm39) missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66,504,674 (GRCm39) missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66,466,769 (GRCm39) missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66,513,665 (GRCm39) missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66,476,686 (GRCm39) missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66,487,071 (GRCm39) missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66,469,216 (GRCm39) missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66,476,704 (GRCm39) missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66,508,762 (GRCm39) missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66,487,634 (GRCm39) missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66,508,669 (GRCm39) missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66,508,673 (GRCm39) missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66,504,752 (GRCm39) critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66,501,673 (GRCm39) missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66,481,396 (GRCm39) missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66,502,762 (GRCm39) missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66,476,689 (GRCm39) missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66,476,638 (GRCm39) missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66,469,599 (GRCm39) missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66,508,733 (GRCm39) missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66,475,933 (GRCm39) missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66,487,084 (GRCm39) missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66,502,768 (GRCm39) missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66,511,797 (GRCm39) missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66,475,922 (GRCm39) missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66,511,789 (GRCm39) missense possibly damaging 0.81
R8857:Phf20l1 UTSW 15 66,513,781 (GRCm39) missense probably benign 0.03
R9295:Phf20l1 UTSW 15 66,513,752 (GRCm39) missense probably damaging 1.00
R9393:Phf20l1 UTSW 15 66,475,955 (GRCm39) missense probably damaging 1.00
R9442:Phf20l1 UTSW 15 66,484,888 (GRCm39) nonsense probably null
R9522:Phf20l1 UTSW 15 66,504,669 (GRCm39) missense possibly damaging 0.89
R9727:Phf20l1 UTSW 15 66,487,231 (GRCm39) missense probably benign 0.01
X0065:Phf20l1 UTSW 15 66,501,655 (GRCm39) nonsense probably null
X0065:Phf20l1 UTSW 15 66,469,527 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTCAACGTGCATAGTCACAGCAG -3'
(R):5'- CGCTAACATGAAGTCTCTAGCACCC -3'

Sequencing Primer
(F):5'- TGCTCCTAGCACAATAGGTG -3'
(R):5'- ATGAAGTCTCTAGCACCCCTACTC -3'
Posted On 2014-03-14