Incidental Mutation 'R1458:Pde10a'
ID161924
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 039513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1458 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8964708 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 832 (D832V)
Ref Sequence ENSEMBL: ENSMUSP00000156356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024647
AA Change: D470V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: D470V

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: D550V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: D550V

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115708
AA Change: D266V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: D266V

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115715
AA Change: D470V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: D470V

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: D533V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: D533V

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115724
AA Change: D604V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: D604V

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149440
AA Change: D481V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: D481V

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: D832V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Abce1 T C 8: 79,707,235 K63R possibly damaging Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Arhgef12 A G 9: 42,988,998 S860P probably damaging Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cic T C 7: 25,279,737 probably benign Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gm7534 T C 4: 134,196,833 D467G probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Mrpl21 A G 19: 3,284,808 Y50C possibly damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Phf20l1 T A 15: 66,604,813 F253Y probably damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
buzzed UTSW 17 8930537 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCTGCTATGCTGGCCTTGTCATAC -3'
(R):5'- CCCTTGTTCTGGAGGAGACCAAAAG -3'

Sequencing Primer
(F):5'- ATACAGTCTCTTCTCCACACAG -3'
(R):5'- cacacacacacacacacacac -3'
Posted On2014-03-14