Incidental Mutation 'R1458:Mrpl21'
ID161932
Institutional Source Beutler Lab
Gene Symbol Mrpl21
Ensembl Gene ENSMUSG00000024829
Gene Namemitochondrial ribosomal protein L21
Synonyms
MMRRC Submission 039513-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1458 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3282901-3292837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3284808 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 50 (Y50C)
Ref Sequence ENSEMBL: ENSMUSP00000025745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025743] [ENSMUST00000025745] [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000141610] [ENSMUST00000154537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025743
AA Change: Y50C

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025743
Gene: ENSMUSG00000024829
AA Change: Y50C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Ribosomal_L21p 99 197 7.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000025745
AA Change: Y50C

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025745
Gene: ENSMUSG00000024829
AA Change: Y50C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Ribosomal_L21p 99 192 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025751
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119292
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139844
Predicted Effect probably benign
Transcript: ENSMUST00000141610
AA Change: Y50C

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120330
Gene: ENSMUSG00000024829
AA Change: Y50C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:4CE4|V 14 53 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185105
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Abce1 T C 8: 79,707,235 K63R possibly damaging Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Arhgef12 A G 9: 42,988,998 S860P probably damaging Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cic T C 7: 25,279,737 probably benign Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gm7534 T C 4: 134,196,833 D467G probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pde10a A T 17: 8,964,708 D832V probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Phf20l1 T A 15: 66,604,813 F253Y probably damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Mrpl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Mrpl21 APN 19 3292529 unclassified probably benign
R0079:Mrpl21 UTSW 19 3284807 missense possibly damaging 0.50
R0410:Mrpl21 UTSW 19 3284792 missense possibly damaging 0.83
R0449:Mrpl21 UTSW 19 3292459 unclassified probably benign
R4229:Mrpl21 UTSW 19 3286901 missense probably damaging 0.98
R5269:Mrpl21 UTSW 19 3287012 missense probably damaging 1.00
R5327:Mrpl21 UTSW 19 3287009 unclassified probably null
R6148:Mrpl21 UTSW 19 3283084 missense probably benign 0.00
R6708:Mrpl21 UTSW 19 3286890 missense probably damaging 1.00
R7219:Mrpl21 UTSW 19 3286998 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCCCTGGACTGTTCACAGACAAG -3'
(R):5'- GCTATGGAGGGGCATAAAACCCAC -3'

Sequencing Primer
(F):5'- TCACAGACAAGTTGTAATACAGTAGG -3'
(R):5'- gctgaaggaggaacccaag -3'
Posted On2014-03-14