Incidental Mutation 'R1459:Hnrnpr'
ID 161952
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Name heterogeneous nuclear ribonucleoprotein R
Synonyms hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
MMRRC Submission 039514-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1459 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 136038253-136086758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 136056755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 252 (S252T)
Ref Sequence ENSEMBL: ENSMUSP00000138399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000125696] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843]
AlphaFold Q8VHM5
Predicted Effect possibly damaging
Transcript: ENSMUST00000084219
AA Change: S151T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: S151T

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105850
AA Change: S252T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: S252T

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125696
Predicted Effect possibly damaging
Transcript: ENSMUST00000131671
AA Change: S151T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: S151T

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134524
AA Change: S252T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037
AA Change: S252T

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145282
Predicted Effect probably damaging
Transcript: ENSMUST00000148843
AA Change: S252T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: S252T

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Meta Mutation Damage Score 0.4963 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,450,578 (GRCm39) R51W probably damaging Het
Abcb1a T A 5: 8,752,920 (GRCm39) L557Q probably damaging Het
Abcb4 T C 5: 8,968,662 (GRCm39) F334L possibly damaging Het
Adamts14 T A 10: 61,034,583 (GRCm39) T1102S probably benign Het
Adamtsl1 T C 4: 86,344,102 (GRCm39) Y1719H probably damaging Het
Adcyap1 T C 17: 93,507,550 (GRCm39) probably null Het
Ankrd13c T A 3: 157,677,947 (GRCm39) L219Q probably damaging Het
Ano3 C A 2: 110,711,174 (GRCm39) A97S probably benign Het
Apaf1 T C 10: 90,898,022 (GRCm39) N245S probably benign Het
Apob A G 12: 8,056,047 (GRCm39) T1510A probably benign Het
Apob A G 12: 8,061,937 (GRCm39) D3473G possibly damaging Het
Arfgap3 G A 15: 83,191,138 (GRCm39) T12I probably benign Het
Bend4 A G 5: 67,557,418 (GRCm39) V466A probably damaging Het
Bend7 G A 2: 4,749,239 (GRCm39) E119K probably damaging Het
Capn5 G T 7: 97,781,049 (GRCm39) R243S possibly damaging Het
Cd84 A G 1: 171,679,510 (GRCm39) I63V probably benign Het
Cd86 T A 16: 36,449,350 (GRCm39) T16S probably benign Het
Cdc42bpb A G 12: 111,262,734 (GRCm39) probably benign Het
Cep20 G A 16: 14,122,380 (GRCm39) T128I possibly damaging Het
Cep95 C T 11: 106,708,781 (GRCm39) S26L probably damaging Het
Cldn19 C T 4: 119,112,810 (GRCm39) A14V probably damaging Het
Cluap1 T A 16: 3,755,453 (GRCm39) M356K probably damaging Het
Coq7 C T 7: 118,109,260 (GRCm39) G263S unknown Het
Ctnnd2 A C 15: 30,847,445 (GRCm39) T679P probably damaging Het
Dnah10 A G 5: 124,820,750 (GRCm39) D528G possibly damaging Het
Dvl1 T A 4: 155,938,476 (GRCm39) N133K probably damaging Het
Efcab7 T G 4: 99,769,744 (GRCm39) H550Q probably null Het
Fastkd5 C T 2: 130,456,717 (GRCm39) M624I probably damaging Het
Fbxo42 T C 4: 140,895,073 (GRCm39) V12A probably benign Het
Gabarapl1 T A 6: 129,515,635 (GRCm39) M91K possibly damaging Het
Gas7 A G 11: 67,552,902 (GRCm39) N154S probably damaging Het
Gm21814 T A 6: 149,483,650 (GRCm39) noncoding transcript Het
Gnl3 G A 14: 30,739,803 (GRCm39) R12C probably damaging Het
Golga2 T G 2: 32,187,807 (GRCm39) probably null Het
Grk3 T A 5: 113,062,878 (GRCm39) R656S probably benign Het
Gsap T A 5: 21,412,236 (GRCm39) probably benign Het
H60c T C 10: 3,210,240 (GRCm39) Q103R probably benign Het
Itgb4 A T 11: 115,869,937 (GRCm39) T40S probably benign Het
Krtap27-1 T C 16: 88,468,302 (GRCm39) N81D probably benign Het
Lilrb4a T A 10: 51,367,683 (GRCm39) L75Q probably benign Het
Lrp2 T A 2: 69,313,738 (GRCm39) D2331V probably damaging Het
Lrp2 T A 2: 69,290,821 (GRCm39) E3546D probably damaging Het
Lzts2 T A 19: 45,009,893 (GRCm39) V9E probably damaging Het
Matr3 T A 18: 35,717,709 (GRCm39) D302E probably benign Het
Mcoln2 A G 3: 145,897,979 (GRCm39) probably null Het
Metap2 T C 10: 93,704,811 (GRCm39) D272G probably damaging Het
Mitf A G 6: 97,987,428 (GRCm39) D337G probably damaging Het
Mrtfb T C 16: 13,219,433 (GRCm39) V693A possibly damaging Het
Msh2 A G 17: 87,985,771 (GRCm39) E116G probably benign Het
Nlrp10 T A 7: 108,523,555 (GRCm39) M642L probably benign Het
Noxa1 G T 2: 24,982,558 (GRCm39) Q86K probably benign Het
Nrap T C 19: 56,372,562 (GRCm39) T48A probably benign Het
Nup160 T A 2: 90,520,494 (GRCm39) H308Q probably damaging Het
Osbpl11 T C 16: 33,056,699 (GRCm39) L711P probably damaging Het
Osbpl6 A G 2: 76,385,409 (GRCm39) N281S probably benign Het
Pcnp C T 16: 55,844,703 (GRCm39) E66K possibly damaging Het
Phf11 T A 14: 59,482,227 (GRCm39) E175D probably damaging Het
Pik3cg A G 12: 32,254,983 (GRCm39) Y335H probably damaging Het
Plekhg4 T C 8: 106,108,431 (GRCm39) L1053S probably damaging Het
Plekhh2 G T 17: 84,918,203 (GRCm39) E1271* probably null Het
Ppp2r2b T A 18: 42,871,055 (GRCm39) Y82F probably damaging Het
Prkd3 T C 17: 79,278,796 (GRCm39) D430G probably damaging Het
Prl7d1 C T 13: 27,893,240 (GRCm39) D224N possibly damaging Het
Ptpdc1 A T 13: 48,740,173 (GRCm39) N419K possibly damaging Het
Serinc5 T A 13: 92,797,695 (GRCm39) probably null Het
Sipa1 A G 19: 5,701,692 (GRCm39) L981P probably damaging Het
Slc16a7 A T 10: 125,066,489 (GRCm39) C383* probably null Het
Slc19a1 C G 10: 76,878,369 (GRCm39) Y301* probably null Het
Slc22a14 A T 9: 119,052,827 (GRCm39) V14E possibly damaging Het
Slpi C A 2: 164,196,837 (GRCm39) C95F probably damaging Het
Smurf2 G A 11: 106,743,333 (GRCm39) H225Y possibly damaging Het
Son T C 16: 91,452,230 (GRCm39) S326P possibly damaging Het
Sptb T A 12: 76,658,657 (GRCm39) K1262M probably benign Het
Sugp2 T A 8: 70,696,714 (GRCm39) probably benign Het
Tatdn2 T A 6: 113,687,031 (GRCm39) H747Q probably damaging Het
Tcn2 C A 11: 3,877,516 (GRCm39) R44L probably benign Het
Tenm3 G A 8: 48,689,006 (GRCm39) R2194C probably damaging Het
Tnks2 T A 19: 36,822,931 (GRCm39) probably benign Het
Top3a A T 11: 60,650,188 (GRCm39) I120N probably damaging Het
Umodl1 T A 17: 31,201,232 (GRCm39) probably benign Het
Umodl1 T C 17: 31,205,478 (GRCm39) V662A probably benign Het
Ush2a T C 1: 188,595,048 (GRCm39) S3827P probably benign Het
Vasn T A 16: 4,466,473 (GRCm39) probably null Het
Vmn2r69 A T 7: 85,055,908 (GRCm39) C743* probably null Het
Vmn2r79 C A 7: 86,687,002 (GRCm39) H794Q probably benign Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136,066,856 (GRCm39) missense unknown
IGL00844:Hnrnpr APN 4 136,066,516 (GRCm39) missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136,054,729 (GRCm39) splice site probably benign
IGL01704:Hnrnpr APN 4 136,056,692 (GRCm39) missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136,066,850 (GRCm39) nonsense probably null
IGL01843:Hnrnpr APN 4 136,066,724 (GRCm39) splice site probably benign
IGL01871:Hnrnpr APN 4 136,066,885 (GRCm39) missense unknown
IGL02376:Hnrnpr APN 4 136,046,766 (GRCm39) missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136,046,817 (GRCm39) missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136,043,690 (GRCm39) missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136,056,750 (GRCm39) missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136,054,593 (GRCm39) missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136,066,474 (GRCm39) splice site probably benign
R1917:Hnrnpr UTSW 4 136,059,799 (GRCm39) nonsense probably null
R2007:Hnrnpr UTSW 4 136,046,824 (GRCm39) unclassified probably benign
R2364:Hnrnpr UTSW 4 136,054,640 (GRCm39) missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136,063,624 (GRCm39) missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136,066,657 (GRCm39) intron probably benign
R4232:Hnrnpr UTSW 4 136,066,500 (GRCm39) missense probably benign 0.15
R4433:Hnrnpr UTSW 4 136,044,459 (GRCm39) missense probably benign 0.04
R4664:Hnrnpr UTSW 4 136,044,486 (GRCm39) unclassified probably benign
R4990:Hnrnpr UTSW 4 136,063,609 (GRCm39) missense probably damaging 1.00
R4990:Hnrnpr UTSW 4 136,056,690 (GRCm39) missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136,063,648 (GRCm39) missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136,066,527 (GRCm39) missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136,046,745 (GRCm39) missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136,059,798 (GRCm39) missense probably damaging 0.97
R7067:Hnrnpr UTSW 4 136,054,704 (GRCm39) missense probably damaging 1.00
R7250:Hnrnpr UTSW 4 136,059,746 (GRCm39) missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136,059,886 (GRCm39) missense possibly damaging 0.92
R8213:Hnrnpr UTSW 4 136,044,486 (GRCm39) unclassified probably benign
R8942:Hnrnpr UTSW 4 136,059,791 (GRCm39) missense possibly damaging 0.95
R9008:Hnrnpr UTSW 4 136,056,737 (GRCm39) missense probably damaging 0.97
R9502:Hnrnpr UTSW 4 136,056,681 (GRCm39) missense probably damaging 0.99
R9515:Hnrnpr UTSW 4 136,063,615 (GRCm39) missense probably damaging 1.00
R9516:Hnrnpr UTSW 4 136,063,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTTTCAGCAAGTGTGAGGGAG -3'
(R):5'- GTCAGGCTAACCAGAAATGAGAACTGT -3'

Sequencing Primer
(F):5'- CAAGTGTGAGGGAGCTTGG -3'
(R):5'- GAAATGAGAACTGTCTTCTCCCG -3'
Posted On 2014-03-14