Incidental Mutation 'R1459:Abcb4'
ID161956
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 4
SynonymsPgy-2, Mdr2, Pgy2, mdr-2
MMRRC Submission 039514-MU
Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8893717-8959231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8918662 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 334 (F334L)
Ref Sequence ENSEMBL: ENSMUSP00000142425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
Predicted Effect probably benign
Transcript: ENSMUST00000003717
AA Change: F334L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: F334L

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196067
AA Change: F334L

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: F334L

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199413
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 8950073 missense probably benign 0.02
IGL00663:Abcb4 APN 5 8927916 missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8930745 nonsense probably null
IGL00822:Abcb4 APN 5 8950046 missense probably benign
IGL01080:Abcb4 APN 5 8934258 missense probably damaging 1.00
IGL01152:Abcb4 APN 5 8950678 missense probably benign 0.19
IGL01329:Abcb4 APN 5 8894166 critical splice donor site probably null
IGL01483:Abcb4 APN 5 8927871 missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8946071 splice site probably null
IGL01785:Abcb4 APN 5 8915058 nonsense probably null
IGL01968:Abcb4 APN 5 8927913 missense probably benign 0.33
IGL02579:Abcb4 APN 5 8955537 missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8927826 missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8934240 missense probably benign
IGL03229:Abcb4 APN 5 8940936 missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8935258 missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8896597 small deletion probably benign
P0014:Abcb4 UTSW 5 8950083 missense probably benign 0.01
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8939835 missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8934243 missense probably benign
R0420:Abcb4 UTSW 5 8941050 missense probably benign 0.03
R0449:Abcb4 UTSW 5 8939885 nonsense probably null
R0609:Abcb4 UTSW 5 8947376 missense probably damaging 0.96
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8928578 critical splice donor site probably null
R1944:Abcb4 UTSW 5 8930796 missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8905989 missense probably benign 0.01
R2256:Abcb4 UTSW 5 8958431 missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8896610 missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8936783 critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8918771 missense probably benign 0.44
R4512:Abcb4 UTSW 5 8928573 missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8947328 missense probably benign 0.01
R4628:Abcb4 UTSW 5 8907399 missense probably benign 0.08
R4708:Abcb4 UTSW 5 8915125 missense possibly damaging 0.90
R4714:Abcb4 UTSW 5 8930906 splice site probably null
R4754:Abcb4 UTSW 5 8910717 missense probably damaging 1.00
R4846:Abcb4 UTSW 5 8935180 missense probably benign
R4896:Abcb4 UTSW 5 8907267 missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8934327 critical splice donor site probably null
R4994:Abcb4 UTSW 5 8928524 missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8909054 splice site probably null
R5537:Abcb4 UTSW 5 8955485 missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8934320 missense probably benign
R5833:Abcb4 UTSW 5 8958314 missense probably damaging 1.00
R5934:Abcb4 UTSW 5 8930806 missense probably benign 0.18
R6006:Abcb4 UTSW 5 8946026 missense probably damaging 0.99
R6146:Abcb4 UTSW 5 8896587 missense probably benign 0.05
R6183:Abcb4 UTSW 5 8918718 missense probably benign
R6260:Abcb4 UTSW 5 8934219 nonsense probably null
R6561:Abcb4 UTSW 5 8927825 missense probably benign 0.14
R7016:Abcb4 UTSW 5 8936843 missense probably benign 0.35
R7081:Abcb4 UTSW 5 8934263 missense probably benign
R7326:Abcb4 UTSW 5 8934226 missense probably benign 0.00
R7375:Abcb4 UTSW 5 8918671 missense probably benign
R7787:Abcb4 UTSW 5 8909220 missense probably damaging 1.00
R7836:Abcb4 UTSW 5 8934203 missense probably benign
R8128:Abcb4 UTSW 5 8958395 missense probably damaging 1.00
R8350:Abcb4 UTSW 5 8928578 critical splice donor site probably null
R8438:Abcb4 UTSW 5 8946120 critical splice donor site probably null
R8447:Abcb4 UTSW 5 8907278 missense probably damaging 0.97
R8710:Abcb4 UTSW 5 8955495 missense probably damaging 1.00
R8777:Abcb4 UTSW 5 8939894 missense probably benign 0.01
R8777-TAIL:Abcb4 UTSW 5 8939894 missense probably benign 0.01
R8837:Abcb4 UTSW 5 8936873 missense probably damaging 0.99
RF015:Abcb4 UTSW 5 8896594 frame shift probably null
RF047:Abcb4 UTSW 5 8896595 frame shift probably null
Z1176:Abcb4 UTSW 5 8959005 missense probably damaging 1.00
Z1177:Abcb4 UTSW 5 8939906 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAACAAATGGTTTGGCAGACTAAACA -3'
(R):5'- ACCATGACTCTCTCAGCTTTCAGACA -3'

Sequencing Primer
(F):5'- gtgagttacaggacagccag -3'
(R):5'- TCTCAGCTTTCAGACAATGAAAGAC -3'
Posted On2014-03-14