Incidental Mutation 'R1459:Capn5'
ID 161967
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 039514-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1459 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 97781049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 243 (R243S)
Ref Sequence ENSEMBL: ENSMUSP00000102729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
AlphaFold O08688
Predicted Effect possibly damaging
Transcript: ENSMUST00000040971
AA Change: R243S

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: R243S

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107112
AA Change: R243S

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: R243S

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Meta Mutation Damage Score 0.1559 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,450,578 (GRCm39) R51W probably damaging Het
Abcb1a T A 5: 8,752,920 (GRCm39) L557Q probably damaging Het
Abcb4 T C 5: 8,968,662 (GRCm39) F334L possibly damaging Het
Adamts14 T A 10: 61,034,583 (GRCm39) T1102S probably benign Het
Adamtsl1 T C 4: 86,344,102 (GRCm39) Y1719H probably damaging Het
Adcyap1 T C 17: 93,507,550 (GRCm39) probably null Het
Ankrd13c T A 3: 157,677,947 (GRCm39) L219Q probably damaging Het
Ano3 C A 2: 110,711,174 (GRCm39) A97S probably benign Het
Apaf1 T C 10: 90,898,022 (GRCm39) N245S probably benign Het
Apob A G 12: 8,056,047 (GRCm39) T1510A probably benign Het
Apob A G 12: 8,061,937 (GRCm39) D3473G possibly damaging Het
Arfgap3 G A 15: 83,191,138 (GRCm39) T12I probably benign Het
Bend4 A G 5: 67,557,418 (GRCm39) V466A probably damaging Het
Bend7 G A 2: 4,749,239 (GRCm39) E119K probably damaging Het
Cd84 A G 1: 171,679,510 (GRCm39) I63V probably benign Het
Cd86 T A 16: 36,449,350 (GRCm39) T16S probably benign Het
Cdc42bpb A G 12: 111,262,734 (GRCm39) probably benign Het
Cep20 G A 16: 14,122,380 (GRCm39) T128I possibly damaging Het
Cep95 C T 11: 106,708,781 (GRCm39) S26L probably damaging Het
Cldn19 C T 4: 119,112,810 (GRCm39) A14V probably damaging Het
Cluap1 T A 16: 3,755,453 (GRCm39) M356K probably damaging Het
Coq7 C T 7: 118,109,260 (GRCm39) G263S unknown Het
Ctnnd2 A C 15: 30,847,445 (GRCm39) T679P probably damaging Het
Dnah10 A G 5: 124,820,750 (GRCm39) D528G possibly damaging Het
Dvl1 T A 4: 155,938,476 (GRCm39) N133K probably damaging Het
Efcab7 T G 4: 99,769,744 (GRCm39) H550Q probably null Het
Fastkd5 C T 2: 130,456,717 (GRCm39) M624I probably damaging Het
Fbxo42 T C 4: 140,895,073 (GRCm39) V12A probably benign Het
Gabarapl1 T A 6: 129,515,635 (GRCm39) M91K possibly damaging Het
Gas7 A G 11: 67,552,902 (GRCm39) N154S probably damaging Het
Gm21814 T A 6: 149,483,650 (GRCm39) noncoding transcript Het
Gnl3 G A 14: 30,739,803 (GRCm39) R12C probably damaging Het
Golga2 T G 2: 32,187,807 (GRCm39) probably null Het
Grk3 T A 5: 113,062,878 (GRCm39) R656S probably benign Het
Gsap T A 5: 21,412,236 (GRCm39) probably benign Het
H60c T C 10: 3,210,240 (GRCm39) Q103R probably benign Het
Hnrnpr T A 4: 136,056,755 (GRCm39) S252T probably damaging Het
Itgb4 A T 11: 115,869,937 (GRCm39) T40S probably benign Het
Krtap27-1 T C 16: 88,468,302 (GRCm39) N81D probably benign Het
Lilrb4a T A 10: 51,367,683 (GRCm39) L75Q probably benign Het
Lrp2 T A 2: 69,313,738 (GRCm39) D2331V probably damaging Het
Lrp2 T A 2: 69,290,821 (GRCm39) E3546D probably damaging Het
Lzts2 T A 19: 45,009,893 (GRCm39) V9E probably damaging Het
Matr3 T A 18: 35,717,709 (GRCm39) D302E probably benign Het
Mcoln2 A G 3: 145,897,979 (GRCm39) probably null Het
Metap2 T C 10: 93,704,811 (GRCm39) D272G probably damaging Het
Mitf A G 6: 97,987,428 (GRCm39) D337G probably damaging Het
Mrtfb T C 16: 13,219,433 (GRCm39) V693A possibly damaging Het
Msh2 A G 17: 87,985,771 (GRCm39) E116G probably benign Het
Nlrp10 T A 7: 108,523,555 (GRCm39) M642L probably benign Het
Noxa1 G T 2: 24,982,558 (GRCm39) Q86K probably benign Het
Nrap T C 19: 56,372,562 (GRCm39) T48A probably benign Het
Nup160 T A 2: 90,520,494 (GRCm39) H308Q probably damaging Het
Osbpl11 T C 16: 33,056,699 (GRCm39) L711P probably damaging Het
Osbpl6 A G 2: 76,385,409 (GRCm39) N281S probably benign Het
Pcnp C T 16: 55,844,703 (GRCm39) E66K possibly damaging Het
Phf11 T A 14: 59,482,227 (GRCm39) E175D probably damaging Het
Pik3cg A G 12: 32,254,983 (GRCm39) Y335H probably damaging Het
Plekhg4 T C 8: 106,108,431 (GRCm39) L1053S probably damaging Het
Plekhh2 G T 17: 84,918,203 (GRCm39) E1271* probably null Het
Ppp2r2b T A 18: 42,871,055 (GRCm39) Y82F probably damaging Het
Prkd3 T C 17: 79,278,796 (GRCm39) D430G probably damaging Het
Prl7d1 C T 13: 27,893,240 (GRCm39) D224N possibly damaging Het
Ptpdc1 A T 13: 48,740,173 (GRCm39) N419K possibly damaging Het
Serinc5 T A 13: 92,797,695 (GRCm39) probably null Het
Sipa1 A G 19: 5,701,692 (GRCm39) L981P probably damaging Het
Slc16a7 A T 10: 125,066,489 (GRCm39) C383* probably null Het
Slc19a1 C G 10: 76,878,369 (GRCm39) Y301* probably null Het
Slc22a14 A T 9: 119,052,827 (GRCm39) V14E possibly damaging Het
Slpi C A 2: 164,196,837 (GRCm39) C95F probably damaging Het
Smurf2 G A 11: 106,743,333 (GRCm39) H225Y possibly damaging Het
Son T C 16: 91,452,230 (GRCm39) S326P possibly damaging Het
Sptb T A 12: 76,658,657 (GRCm39) K1262M probably benign Het
Sugp2 T A 8: 70,696,714 (GRCm39) probably benign Het
Tatdn2 T A 6: 113,687,031 (GRCm39) H747Q probably damaging Het
Tcn2 C A 11: 3,877,516 (GRCm39) R44L probably benign Het
Tenm3 G A 8: 48,689,006 (GRCm39) R2194C probably damaging Het
Tnks2 T A 19: 36,822,931 (GRCm39) probably benign Het
Top3a A T 11: 60,650,188 (GRCm39) I120N probably damaging Het
Umodl1 T A 17: 31,201,232 (GRCm39) probably benign Het
Umodl1 T C 17: 31,205,478 (GRCm39) V662A probably benign Het
Ush2a T C 1: 188,595,048 (GRCm39) S3827P probably benign Het
Vasn T A 16: 4,466,473 (GRCm39) probably null Het
Vmn2r69 A T 7: 85,055,908 (GRCm39) C743* probably null Het
Vmn2r79 C A 7: 86,687,002 (GRCm39) H794Q probably benign Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACTGTCCTTGATGAACCTACC -3'
(R):5'- GGGGCAAGTTGGCACCAATATACTC -3'

Sequencing Primer
(F):5'- TTACACTGGAAAGTAAGTCTCCC -3'
(R):5'- gtgtgtgtgtgtgtgGTCC -3'
Posted On 2014-03-14