Incidental Mutation 'R1459:Apaf1'
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91062160 bp
Amino Acid Change Asparagine to Serine at position 245 (N245S)
Ref Sequence ENSEMBL: ENSMUSP00000124134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000160788] [ENSMUST00000161987] [ENSMUST00000162618]
Predicted Effect probably benign
Transcript: ENSMUST00000020157
AA Change: N256S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: N256S

Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159110
AA Change: N256S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: N256S

Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160788
SMART Domains Protein: ENSMUSP00000124968
Gene: ENSMUSG00000019979

Pfam:CARD 6 90 1e-21 PFAM
Pfam:NB-ARC 129 238 6.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161987
SMART Domains Protein: ENSMUSP00000124422
Gene: ENSMUSG00000019979

Pfam:CARD 6 90 1e-21 PFAM
Pfam:NB-ARC 129 238 6.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162618
AA Change: N245S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: N245S

Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
Wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
R7913:Apaf1 UTSW 10 91060271 missense probably damaging 0.99
R7914:Apaf1 UTSW 10 91060233 missense probably damaging 1.00
R7922:Apaf1 UTSW 10 90999753 missense probably benign
R8131:Apaf1 UTSW 10 91077558 missense possibly damaging 0.93
R8158:Apaf1 UTSW 10 91059658 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcatgactttaatcccagcac -3'
Posted On2014-03-14