Incidental Mutation 'R1459:Son'
ID162005
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene NameSon DNA binding protein
Synonyms2900011L12Rik
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91647506-91679221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91655342 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 326 (S326P)
Ref Sequence ENSEMBL: ENSMUSP00000109671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114036
AA Change: S326P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: S326P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114037
AA Change: S326P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: S326P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117633
AA Change: S326P

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: S326P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119368
AA Change: S326P

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: S326P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140312
AA Change: S326P

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: S326P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Meta Mutation Damage Score 0.0634 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1587:Son UTSW 16 91659718 missense probably damaging 1.00
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 unclassified probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 unclassified probably null
R2871:Son UTSW 16 91664317 unclassified probably null
R2872:Son UTSW 16 91664317 unclassified probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6753:Son UTSW 16 91657188 missense probably damaging 0.99
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7514:Son UTSW 16 91654860 missense probably damaging 0.99
R7555:Son UTSW 16 91658922 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
R7856:Son UTSW 16 91659258 missense probably damaging 0.99
R7870:Son UTSW 16 91656598 unclassified probably benign
R7939:Son UTSW 16 91659258 missense probably damaging 0.99
R8000:Son UTSW 16 91660334 small deletion probably benign
RF007:Son UTSW 16 91659369 missense possibly damaging 0.53
RF021:Son UTSW 16 91656691 unclassified probably benign
RF041:Son UTSW 16 91656691 unclassified probably benign
Z1176:Son UTSW 16 91655801 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCAGTGCCTATGTCAACAGCG -3'
(R):5'- GGCAATTCCTGCGACAACTGTG -3'

Sequencing Primer
(F):5'- TCAGTGGAATATCAGAAGTCTGTGC -3'
(R):5'- TGACAACTCTGGCACTGG -3'
Posted On2014-03-14