Mutagenetix > Incidental Mutations

Incidental Mutation 'R1459:Umodl1'

162006

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

039514-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1459 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 30982258 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

Predicted Effect

probably benign
Transcript: ENSMUST00000066554

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

96% (87/91)

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	C	T	4: 62,532,341	R51W	probably damaging	Het
Abcb1a	T	A	5: 8,702,920	L557Q	probably damaging	Het
Abcb4	T	C	5: 8,918,662	F334L	possibly damaging	Het
Adamts14	T	A	10: 61,198,804	T1102S	probably benign	Het
Adamtsl1	T	C	4: 86,425,865	Y1719H	probably damaging	Het
Adcyap1	T	C	17: 93,200,122		probably null	Het
Ankrd13c	T	A	3: 157,972,310	L219Q	probably damaging	Het
Ano3	C	A	2: 110,880,829	A97S	probably benign	Het
Apaf1	T	C	10: 91,062,160	N245S	probably benign	Het
Apob	A	G	12: 8,006,047	T1510A	probably benign	Het
Apob	A	G	12: 8,011,937	D3473G	possibly damaging	Het
Arfgap3	G	A	15: 83,306,937	T12I	probably benign	Het
Bend4	A	G	5: 67,400,075	V466A	probably damaging	Het
Bend7	G	A	2: 4,744,428	E119K	probably damaging	Het
Capn5	G	T	7: 98,131,842	R243S	possibly damaging	Het
Cd84	A	G	1: 171,851,943	I63V	probably benign	Het
Cd86	T	A	16: 36,628,988	T16S	probably benign	Het
Cdc42bpb	A	G	12: 111,296,300		probably benign	Het
Cep95	C	T	11: 106,817,955	S26L	probably damaging	Het
Cldn19	C	T	4: 119,255,613	A14V	probably damaging	Het
Cluap1	T	A	16: 3,937,589	M356K	probably damaging	Het
Coq7	C	T	7: 118,510,037	G263S	unknown	Het
Ctnnd2	A	C	15: 30,847,299	T679P	probably damaging	Het
Dnah10	A	G	5: 124,743,686	D528G	possibly damaging	Het
Dvl1	T	A	4: 155,854,019	N133K	probably damaging	Het
Efcab7	T	G	4: 99,912,547	H550Q	probably null	Het
Fastkd5	C	T	2: 130,614,797	M624I	probably damaging	Het
Fbxo42	T	C	4: 141,167,762	V12A	probably benign	Het
Fopnl	G	A	16: 14,304,516	T128I	possibly damaging	Het
Gabarapl1	T	A	6: 129,538,672	M91K	possibly damaging	Het
Gas7	A	G	11: 67,662,076	N154S	probably damaging	Het
Gm21814	T	A	6: 149,582,152		noncoding transcript	Het
Gm6904	T	A	14: 59,244,778	E175D	probably damaging	Het
Gnl3	G	A	14: 31,017,846	R12C	probably damaging	Het
Golga2	T	G	2: 32,297,795		probably null	Het
Grk3	T	A	5: 112,915,012	R656S	probably benign	Het
Gsap	T	A	5: 21,207,238		probably benign	Het
H60c	T	C	10: 3,260,240	Q103R	probably benign	Het
Hnrnpr	T	A	4: 136,329,444	S252T	probably damaging	Het
Itgb4	A	T	11: 115,979,111	T40S	probably benign	Het
Krtap27-1	T	C	16: 88,671,414	N81D	probably benign	Het
Lilrb4a	T	A	10: 51,491,587	L75Q	probably benign	Het
Lrp2	T	A	2: 69,460,477	E3546D	probably damaging	Het
Lrp2	T	A	2: 69,483,394	D2331V	probably damaging	Het
Lzts2	T	A	19: 45,021,454	V9E	probably damaging	Het
Matr3	T	A	18: 35,584,656	D302E	probably benign	Het
Mcoln2	A	G	3: 146,192,224		probably null	Het
Metap2	T	C	10: 93,868,949	D272G	probably damaging	Het
Mitf	A	G	6: 98,010,467	D337G	probably damaging	Het
Mkl2	T	C	16: 13,401,569	V693A	possibly damaging	Het
Msh2	A	G	17: 87,678,343	E116G	probably benign	Het
Nlrp10	T	A	7: 108,924,348	M642L	probably benign	Het
Noxa1	G	T	2: 25,092,546	Q86K	probably benign	Het
Nrap	T	C	19: 56,384,130	T48A	probably benign	Het
Nup160	T	A	2: 90,690,150	H308Q	probably damaging	Het
Osbpl11	T	C	16: 33,236,329	L711P	probably damaging	Het
Osbpl6	A	G	2: 76,555,065	N281S	probably benign	Het
Pcnp	C	T	16: 56,024,340	E66K	possibly damaging	Het
Pik3cg	A	G	12: 32,204,984	Y335H	probably damaging	Het
Plekhg4	T	C	8: 105,381,799	L1053S	probably damaging	Het
Plekhh2	G	T	17: 84,610,775	E1271*	probably null	Het
Ppp2r2b	T	A	18: 42,737,990	Y82F	probably damaging	Het
Prkd3	T	C	17: 78,971,367	D430G	probably damaging	Het
Prl7d1	C	T	13: 27,709,257	D224N	possibly damaging	Het
Ptpdc1	A	T	13: 48,586,697	N419K	possibly damaging	Het
Serinc5	T	A	13: 92,661,187		probably null	Het
Sipa1	A	G	19: 5,651,664	L981P	probably damaging	Het
Slc16a7	A	T	10: 125,230,620	C383*	probably null	Het
Slc19a1	C	G	10: 77,042,535	Y301*	probably null	Het
Slc22a14	A	T	9: 119,223,761	V14E	possibly damaging	Het
Slpi	C	A	2: 164,354,917	C95F	probably damaging	Het
Smurf2	G	A	11: 106,852,507	H225Y	possibly damaging	Het
Son	T	C	16: 91,655,342	S326P	possibly damaging	Het
Sptb	T	A	12: 76,611,883	K1262M	probably benign	Het
Sugp2	T	A	8: 70,244,064		probably benign	Het
Tatdn2	T	A	6: 113,710,070	H747Q	probably damaging	Het
Tcn2	C	A	11: 3,927,516	R44L	probably benign	Het
Tenm3	G	A	8: 48,235,971	R2194C	probably damaging	Het
Tnks2	T	A	19: 36,845,531		probably benign	Het
Top3a	A	T	11: 60,759,362	I120N	probably damaging	Het
Ush2a	T	C	1: 188,862,851	S3827P	probably benign	Het
Vasn	T	A	16: 4,648,609		probably null	Het
Vmn2r69	A	T	7: 85,406,700	C743*	probably null	Het
Vmn2r79	C	A	7: 87,037,794	H794Q	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- AAGTCTGGTGACTCAGTGTCCCTG -3'
(R):5'- ACTTTGCCCAACCACAAGGAGG -3'

Sequencing Primer
(F):5'- GAGCAAGTGTCAGTGTTACCATTC -3'
(R):5'- tgtatgtgtgtgtttgtccttc -3'

Posted On

2014-03-14