Mutagenetix > Incidental Mutations

Incidental Mutation 'R1459:Umodl1'

162006

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

039514-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1459 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 30982258 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

Predicted Effect

probably benign
Transcript: ENSMUST00000066554

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

96% (87/91)

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	C	T	4: 62,532,341	R51W	probably damaging	Het
Abcb1a	T	A	5: 8,702,920	L557Q	probably damaging	Het
Abcb4	T	C	5: 8,918,662	F334L	possibly damaging	Het
Adamts14	T	A	10: 61,198,804	T1102S	probably benign	Het
Adamtsl1	T	C	4: 86,425,865	Y1719H	probably damaging	Het
Adcyap1	T	C	17: 93,200,122		probably null	Het
Ankrd13c	T	A	3: 157,972,310	L219Q	probably damaging	Het
Ano3	C	A	2: 110,880,829	A97S	probably benign	Het
Apaf1	T	C	10: 91,062,160	N245S	probably benign	Het
Apob	A	G	12: 8,006,047	T1510A	probably benign	Het
Apob	A	G	12: 8,011,937	D3473G	possibly damaging	Het
Arfgap3	G	A	15: 83,306,937	T12I	probably benign	Het
Bend4	A	G	5: 67,400,075	V466A	probably damaging	Het
Bend7	G	A	2: 4,744,428	E119K	probably damaging	Het
Capn5	G	T	7: 98,131,842	R243S	possibly damaging	Het
Cd84	A	G	1: 171,851,943	I63V	probably benign	Het
Cd86	T	A	16: 36,628,988	T16S	probably benign	Het
Cdc42bpb	A	G	12: 111,296,300		probably benign	Het
Cep95	C	T	11: 106,817,955	S26L	probably damaging	Het
Cldn19	C	T	4: 119,255,613	A14V	probably damaging	Het
Cluap1	T	A	16: 3,937,589	M356K	probably damaging	Het
Coq7	C	T	7: 118,510,037	G263S	unknown	Het
Ctnnd2	A	C	15: 30,847,299	T679P	probably damaging	Het
Dnah10	A	G	5: 124,743,686	D528G	possibly damaging	Het
Dvl1	T	A	4: 155,854,019	N133K	probably damaging	Het
Efcab7	T	G	4: 99,912,547	H550Q	probably null	Het
Fastkd5	C	T	2: 130,614,797	M624I	probably damaging	Het
Fbxo42	T	C	4: 141,167,762	V12A	probably benign	Het
Fopnl	G	A	16: 14,304,516	T128I	possibly damaging	Het
Gabarapl1	T	A	6: 129,538,672	M91K	possibly damaging	Het
Gas7	A	G	11: 67,662,076	N154S	probably damaging	Het
Gm21814	T	A	6: 149,582,152		noncoding transcript	Het
Gm6904	T	A	14: 59,244,778	E175D	probably damaging	Het
Gnl3	G	A	14: 31,017,846	R12C	probably damaging	Het
Golga2	T	G	2: 32,297,795		probably null	Het
Grk3	T	A	5: 112,915,012	R656S	probably benign	Het
Gsap	T	A	5: 21,207,238		probably benign	Het
H60c	T	C	10: 3,260,240	Q103R	probably benign	Het
Hnrnpr	T	A	4: 136,329,444	S252T	probably damaging	Het
Itgb4	A	T	11: 115,979,111	T40S	probably benign	Het
Krtap27-1	T	C	16: 88,671,414	N81D	probably benign	Het
Lilrb4a	T	A	10: 51,491,587	L75Q	probably benign	Het
Lrp2	T	A	2: 69,460,477	E3546D	probably damaging	Het
Lrp2	T	A	2: 69,483,394	D2331V	probably damaging	Het
Lzts2	T	A	19: 45,021,454	V9E	probably damaging	Het
Matr3	T	A	18: 35,584,656	D302E	probably benign	Het
Mcoln2	A	G	3: 146,192,224		probably null	Het
Metap2	T	C	10: 93,868,949	D272G	probably damaging	Het
Mitf	A	G	6: 98,010,467	D337G	probably damaging	Het
Mkl2	T	C	16: 13,401,569	V693A	possibly damaging	Het
Msh2	A	G	17: 87,678,343	E116G	probably benign	Het
Nlrp10	T	A	7: 108,924,348	M642L	probably benign	Het
Noxa1	G	T	2: 25,092,546	Q86K	probably benign	Het
Nrap	T	C	19: 56,384,130	T48A	probably benign	Het
Nup160	T	A	2: 90,690,150	H308Q	probably damaging	Het
Osbpl11	T	C	16: 33,236,329	L711P	probably damaging	Het
Osbpl6	A	G	2: 76,555,065	N281S	probably benign	Het
Pcnp	C	T	16: 56,024,340	E66K	possibly damaging	Het
Pik3cg	A	G	12: 32,204,984	Y335H	probably damaging	Het
Plekhg4	T	C	8: 105,381,799	L1053S	probably damaging	Het
Plekhh2	G	T	17: 84,610,775	E1271*	probably null	Het
Ppp2r2b	T	A	18: 42,737,990	Y82F	probably damaging	Het
Prkd3	T	C	17: 78,971,367	D430G	probably damaging	Het
Prl7d1	C	T	13: 27,709,257	D224N	possibly damaging	Het
Ptpdc1	A	T	13: 48,586,697	N419K	possibly damaging	Het
Serinc5	T	A	13: 92,661,187		probably null	Het
Sipa1	A	G	19: 5,651,664	L981P	probably damaging	Het
Slc16a7	A	T	10: 125,230,620	C383*	probably null	Het
Slc19a1	C	G	10: 77,042,535	Y301*	probably null	Het
Slc22a14	A	T	9: 119,223,761	V14E	possibly damaging	Het
Slpi	C	A	2: 164,354,917	C95F	probably damaging	Het
Smurf2	G	A	11: 106,852,507	H225Y	possibly damaging	Het
Son	T	C	16: 91,655,342	S326P	possibly damaging	Het
Sptb	T	A	12: 76,611,883	K1262M	probably benign	Het
Sugp2	T	A	8: 70,244,064		probably benign	Het
Tatdn2	T	A	6: 113,710,070	H747Q	probably damaging	Het
Tcn2	C	A	11: 3,927,516	R44L	probably benign	Het
Tenm3	G	A	8: 48,235,971	R2194C	probably damaging	Het
Tnks2	T	A	19: 36,845,531		probably benign	Het
Top3a	A	T	11: 60,759,362	I120N	probably damaging	Het
Ush2a	T	C	1: 188,862,851	S3827P	probably benign	Het
Vasn	T	A	16: 4,648,609		probably null	Het
Vmn2r69	A	T	7: 85,406,700	C743*	probably null	Het
Vmn2r79	C	A	7: 87,037,794	H794Q	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
floored	UTSW	17	30988057	nonsense	probably null
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGTCTGGTGACTCAGTGTCCCTG -3'
(R):5'- ACTTTGCCCAACCACAAGGAGG -3'

Sequencing Primer
(F):5'- GAGCAAGTGTCAGTGTTACCATTC -3'
(R):5'- tgtatgtgtgtgtttgtccttc -3'

Posted On

2014-03-14