Incidental Mutation 'R1459:Ppp2r2b'
ID162013
Institutional Source Beutler Lab
Gene Symbol Ppp2r2b
Ensembl Gene ENSMUSG00000024500
Gene Nameprotein phosphatase 2, regulatory subunit B, beta
SynonymsSCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42637432-43059471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42737990 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 82 (Y82F)
Ref Sequence ENSEMBL: ENSMUSP00000113411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025377] [ENSMUST00000117687] [ENSMUST00000120632]
Predicted Effect probably benign
Transcript: ENSMUST00000025377
AA Change: Y85F

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500
AA Change: Y85F

DomainStartEndE-ValueType
WD40 14 55 6.42e-1 SMART
WD40 82 122 3.7e0 SMART
WD40 164 203 1.66e0 SMART
WD40 214 254 1.38e1 SMART
WD40 273 311 5.7e1 SMART
Blast:WD40 315 369 6e-26 BLAST
WD40 405 442 1.33e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117687
AA Change: Y82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113731
Gene: ENSMUSG00000024500
AA Change: Y82F

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120632
AA Change: Y82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113411
Gene: ENSMUSG00000024500
AA Change: Y82F

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153737
Meta Mutation Damage Score 0.2870 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Ppp2r2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ppp2r2b APN 18 42645775 missense probably damaging 0.99
IGL01999:Ppp2r2b APN 18 42645723 utr 3 prime probably benign
IGL02610:Ppp2r2b APN 18 42648775 splice site probably benign
IGL02733:Ppp2r2b APN 18 42648728 missense possibly damaging 0.96
IGL02899:Ppp2r2b APN 18 42645809 missense probably damaging 1.00
Degradation UTSW 18 42688338 missense probably benign 0.27
R0737:Ppp2r2b UTSW 18 43059192 missense probably benign
R1616:Ppp2r2b UTSW 18 42688310 missense probably benign 0.32
R1635:Ppp2r2b UTSW 18 43059210 missense probably benign 0.01
R3435:Ppp2r2b UTSW 18 42741109 missense possibly damaging 0.48
R4204:Ppp2r2b UTSW 18 42738050 missense probably benign
R4301:Ppp2r2b UTSW 18 42898746 missense probably null
R5062:Ppp2r2b UTSW 18 42688461 missense possibly damaging 0.48
R5147:Ppp2r2b UTSW 18 42645877 missense probably benign 0.00
R5207:Ppp2r2b UTSW 18 42688352 missense probably damaging 1.00
R5277:Ppp2r2b UTSW 18 42741142 missense probably damaging 1.00
R6004:Ppp2r2b UTSW 18 43059159 splice site probably null
R6528:Ppp2r2b UTSW 18 42688338 missense probably benign 0.27
R6735:Ppp2r2b UTSW 18 42688588 splice site probably null
R7521:Ppp2r2b UTSW 18 43059177 missense probably benign
R7831:Ppp2r2b UTSW 18 42701532 missense probably benign
R8405:Ppp2r2b UTSW 18 42645740 missense probably benign 0.00
R8486:Ppp2r2b UTSW 18 42898804 missense probably benign 0.17
Z1177:Ppp2r2b UTSW 18 42648693 missense probably benign 0.04
Z1177:Ppp2r2b UTSW 18 42688423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATAACGGGCTCCACAAAACTG -3'
(R):5'- ACCAAAGCTGAATCTACGGCTGC -3'

Sequencing Primer
(F):5'- TGCACCATGAATTCTGCTAAGC -3'
(R):5'- TCCCAGAGGGACCCTAATG -3'
Posted On2014-03-14