Incidental Mutation 'R1460:Dhx9'
ID162021
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission 039515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1460 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 153465680 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 607 (D607E)
Ref Sequence ENSEMBL: ENSMUSP00000038135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
Predicted Effect probably benign
Transcript: ENSMUST00000042141
AA Change: D607E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: D607E

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186380
AA Change: D606E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: D606E

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188345
AA Change: D607E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: D607E

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.1%
Validation Efficiency 94% (93/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A T 4: 109,531,210 probably null Het
Abcb11 A G 2: 69,257,374 probably benign Het
Abi3bp T C 16: 56,562,417 V130A probably damaging Het
Adamts4 A G 1: 171,256,440 probably benign Het
Adgrd1 A G 5: 129,122,563 T155A possibly damaging Het
Ano3 A T 2: 110,682,758 S631T probably damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Atg7 G A 6: 114,703,364 A384T probably damaging Het
Atp6v0a1 T A 11: 101,033,998 I303N probably damaging Het
B3gntl1 T G 11: 121,639,798 Y149S probably damaging Het
Btnl2 A G 17: 34,366,450 D475G probably benign Het
Cdcp1 A T 9: 123,180,027 S529T possibly damaging Het
Cenpt A G 8: 105,848,888 L194P probably damaging Het
Chmp4b A G 2: 154,692,595 D177G possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cish G T 9: 107,300,397 E91* probably null Het
Col22a1 T C 15: 71,821,931 D740G unknown Het
Crocc G A 4: 141,029,240 Q1025* probably null Het
Ctrc C A 4: 141,838,809 probably benign Het
Cyb5r2 T A 7: 107,757,243 D7V probably benign Het
Dhx29 T C 13: 112,965,210 probably benign Het
Dirc2 T C 16: 35,719,366 T362A probably benign Het
Dnajb7 C T 15: 81,407,687 G150R probably benign Het
Dnase1l3 T A 14: 7,974,050 T214S probably benign Het
Dpm1 A T 2: 168,210,629 I229N probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Entpd1 T C 19: 40,726,188 V247A probably damaging Het
Ephb3 C A 16: 21,218,922 H277Q probably benign Het
Etl4 A T 2: 20,788,477 N671I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160a1 T C 3: 85,730,876 I39V probably damaging Het
Fancd2os G A 6: 113,598,012 T11I probably damaging Het
Fcrlb G T 1: 170,912,284 probably benign Het
Gm4788 T A 1: 139,698,196 I788F probably damaging Het
Gm9268 A T 7: 43,023,215 R91S probably benign Het
Gm9991 T C 1: 90,679,058 noncoding transcript Het
Gstk1 C T 6: 42,246,595 R40W probably damaging Het
Gstt1 C T 10: 75,784,170 V190M probably damaging Het
Hectd2 G A 19: 36,615,508 W691* probably null Het
Hecw2 T C 1: 53,813,245 T1572A probably damaging Het
Hoxa5 T C 6: 52,203,948 T135A probably benign Het
Igfl3 T A 7: 18,179,955 C77S possibly damaging Het
Itgb4 A G 11: 115,984,164 D449G probably damaging Het
Larp1b T C 3: 40,962,218 V11A probably benign Het
Lhx9 A G 1: 138,838,709 probably benign Het
Lig3 G T 11: 82,795,798 probably benign Het
Lipo4 A C 19: 33,499,318 F343L probably benign Het
Lyn T A 4: 3,789,908 Y480* probably null Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mill1 C A 7: 18,262,670 A137D probably damaging Het
Morc2a A T 11: 3,683,794 R635S probably benign Het
Mpped2 A G 2: 106,744,892 probably benign Het
Mug2 T C 6: 122,040,533 probably benign Het
Mut T C 17: 40,937,375 Y98H probably damaging Het
Mynn C A 3: 30,603,704 S57Y probably damaging Het
Myo3b G A 2: 70,232,454 E333K probably benign Het
Myt1 A T 2: 181,802,932 I514F probably damaging Het
Nlrp4f A G 13: 65,190,268 C708R probably benign Het
Nod2 A G 8: 88,663,812 E249G probably damaging Het
Npy2r T C 3: 82,540,944 I175V probably benign Het
Obscn A T 11: 59,055,966 V4114D probably damaging Het
Olfr1249 A G 2: 89,629,938 probably null Het
Olfr1382 T A 11: 49,535,677 M164K possibly damaging Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr676 T A 7: 105,035,708 I170N possibly damaging Het
Olfr952 A G 9: 39,426,207 M288T probably benign Het
Pbxip1 T A 3: 89,445,614 I196N probably damaging Het
Piezo1 G A 8: 122,502,151 T209M possibly damaging Het
Polr1a T C 6: 71,941,384 M642T probably damaging Het
Prdm4 T C 10: 85,907,822 M190V probably benign Het
Psmd7 G A 8: 107,581,059 S264L possibly damaging Het
Qrich1 T G 9: 108,533,647 probably benign Het
Rapgef4 G T 2: 72,031,176 probably null Het
Rfx5 T C 3: 94,956,325 I95T probably damaging Het
Rgr G A 14: 37,045,726 R113C probably damaging Het
Rnf20 T C 4: 49,645,873 probably benign Het
Rps3a1 G A 3: 86,138,062 A241V probably benign Het
Rsg1 T C 4: 141,218,212 F125L probably damaging Het
Rttn A T 18: 89,109,357 probably benign Het
Scn2a A G 2: 65,701,843 T600A probably damaging Het
Scyl2 T C 10: 89,657,889 D339G possibly damaging Het
Sipa1 T A 19: 5,651,447 H1029L probably benign Het
Snrnp48 A G 13: 38,211,105 T124A probably benign Het
Sptbn1 A T 11: 30,138,637 M875K possibly damaging Het
Supt6 A G 11: 78,222,198 V973A possibly damaging Het
Supv3l1 T C 10: 62,443,383 probably benign Het
Svep1 G T 4: 58,068,740 N3015K possibly damaging Het
Tgfb3 A G 12: 86,059,067 probably benign Het
Trerf1 A G 17: 47,317,845 noncoding transcript Het
Trim24 T A 6: 37,964,826 F904I probably damaging Het
Trim30d T A 7: 104,472,104 Y328F probably benign Het
Ttn T C 2: 76,868,373 E6G probably damaging Het
Ube2m T C 7: 13,035,835 probably benign Het
Wdr90 A T 17: 25,860,448 S237R possibly damaging Het
Zfp735 A T 11: 73,712,333 H701L possibly damaging Het
Zp1 T C 19: 10,918,878 D161G probably benign Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153472707 missense probably benign 0.27
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153458363 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153472673 missense probably benign 0.02
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153472463 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 intron probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7209:Dhx9 UTSW 1 153464623 missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
R7685:Dhx9 UTSW 1 153458406 missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153465001 missense probably benign 0.07
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153456575 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTTCCAGGTACTCTGACATACAGCAAC -3'
(R):5'- TGGCAAGGGAGCACAGCTTAAC -3'

Sequencing Primer
(F):5'- GAGTATATAACCTCAACAGTTCCATC -3'
(R):5'- TGCAATCTTGGGGAGTCAC -3'
Posted On2014-03-14