Mutagenetix > Incidental Mutations

Incidental Mutation 'R1460:Ass1'

162025

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

039515-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1460 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31514741 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 345 (V345I)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably benign
Transcript: ENSMUST00000102840
AA Change: V345I

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: V345I

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.1%

Validation Efficiency

94% (93/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	T	4: 109,531,210		probably null	Het
Abcb11	A	G	2: 69,257,374		probably benign	Het
Abi3bp	T	C	16: 56,562,417	V130A	probably damaging	Het
Adamts4	A	G	1: 171,256,440		probably benign	Het
Adgrd1	A	G	5: 129,122,563	T155A	possibly damaging	Het
Ano3	A	T	2: 110,682,758	S631T	probably damaging	Het
Atg7	G	A	6: 114,703,364	A384T	probably damaging	Het
Atp6v0a1	T	A	11: 101,033,998	I303N	probably damaging	Het
B3gntl1	T	G	11: 121,639,798	Y149S	probably damaging	Het
Btnl2	A	G	17: 34,366,450	D475G	probably benign	Het
Cdcp1	A	T	9: 123,180,027	S529T	possibly damaging	Het
Cenpt	A	G	8: 105,848,888	L194P	probably damaging	Het
Chmp4b	A	G	2: 154,692,595	D177G	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cish	G	T	9: 107,300,397	E91*	probably null	Het
Col22a1	T	C	15: 71,821,931	D740G	unknown	Het
Crocc	G	A	4: 141,029,240	Q1025*	probably null	Het
Ctrc	C	A	4: 141,838,809		probably benign	Het
Cyb5r2	T	A	7: 107,757,243	D7V	probably benign	Het
Dhx29	T	C	13: 112,965,210		probably benign	Het
Dhx9	A	C	1: 153,465,680	D607E	probably benign	Het
Dirc2	T	C	16: 35,719,366	T362A	probably benign	Het
Dnajb7	C	T	15: 81,407,687	G150R	probably benign	Het
Dnase1l3	T	A	14: 7,974,050	T214S	probably benign	Het
Dpm1	A	T	2: 168,210,629	I229N	probably damaging	Het
Dstn	T	C	2: 143,938,488	V36A	possibly damaging	Het
Entpd1	T	C	19: 40,726,188	V247A	probably damaging	Het
Ephb3	C	A	16: 21,218,922	H277Q	probably benign	Het
Etl4	A	T	2: 20,788,477	N671I	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam160a1	T	C	3: 85,730,876	I39V	probably damaging	Het
Fancd2os	G	A	6: 113,598,012	T11I	probably damaging	Het
Fcrlb	G	T	1: 170,912,284		probably benign	Het
Gm4788	T	A	1: 139,698,196	I788F	probably damaging	Het
Gm9268	A	T	7: 43,023,215	R91S	probably benign	Het
Gm9991	T	C	1: 90,679,058		noncoding transcript	Het
Gstk1	C	T	6: 42,246,595	R40W	probably damaging	Het
Gstt1	C	T	10: 75,784,170	V190M	probably damaging	Het
Hectd2	G	A	19: 36,615,508	W691*	probably null	Het
Hecw2	T	C	1: 53,813,245	T1572A	probably damaging	Het
Hoxa5	T	C	6: 52,203,948	T135A	probably benign	Het
Igfl3	T	A	7: 18,179,955	C77S	possibly damaging	Het
Itgb4	A	G	11: 115,984,164	D449G	probably damaging	Het
Larp1b	T	C	3: 40,962,218	V11A	probably benign	Het
Lhx9	A	G	1: 138,838,709		probably benign	Het
Lig3	G	T	11: 82,795,798		probably benign	Het
Lipo4	A	C	19: 33,499,318	F343L	probably benign	Het
Lyn	T	A	4: 3,789,908	Y480*	probably null	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mill1	C	A	7: 18,262,670	A137D	probably damaging	Het
Morc2a	A	T	11: 3,683,794	R635S	probably benign	Het
Mpped2	A	G	2: 106,744,892		probably benign	Het
Mug2	T	C	6: 122,040,533		probably benign	Het
Mut	T	C	17: 40,937,375	Y98H	probably damaging	Het
Mynn	C	A	3: 30,603,704	S57Y	probably damaging	Het
Myo3b	G	A	2: 70,232,454	E333K	probably benign	Het
Myt1	A	T	2: 181,802,932	I514F	probably damaging	Het
Nlrp4f	A	G	13: 65,190,268	C708R	probably benign	Het
Nod2	A	G	8: 88,663,812	E249G	probably damaging	Het
Npy2r	T	C	3: 82,540,944	I175V	probably benign	Het
Obscn	A	T	11: 59,055,966	V4114D	probably damaging	Het
Olfr1249	A	G	2: 89,629,938		probably null	Het
Olfr1382	T	A	11: 49,535,677	M164K	possibly damaging	Het
Olfr355	A	T	2: 36,927,808	M102K	probably damaging	Het
Olfr676	T	A	7: 105,035,708	I170N	possibly damaging	Het
Olfr952	A	G	9: 39,426,207	M288T	probably benign	Het
Pbxip1	T	A	3: 89,445,614	I196N	probably damaging	Het
Piezo1	G	A	8: 122,502,151	T209M	possibly damaging	Het
Polr1a	T	C	6: 71,941,384	M642T	probably damaging	Het
Prdm4	T	C	10: 85,907,822	M190V	probably benign	Het
Psmd7	G	A	8: 107,581,059	S264L	possibly damaging	Het
Qrich1	T	G	9: 108,533,647		probably benign	Het
Rapgef4	G	T	2: 72,031,176		probably null	Het
Rfx5	T	C	3: 94,956,325	I95T	probably damaging	Het
Rgr	G	A	14: 37,045,726	R113C	probably damaging	Het
Rnf20	T	C	4: 49,645,873		probably benign	Het
Rps3a1	G	A	3: 86,138,062	A241V	probably benign	Het
Rsg1	T	C	4: 141,218,212	F125L	probably damaging	Het
Rttn	A	T	18: 89,109,357		probably benign	Het
Scn2a	A	G	2: 65,701,843	T600A	probably damaging	Het
Scyl2	T	C	10: 89,657,889	D339G	possibly damaging	Het
Sipa1	T	A	19: 5,651,447	H1029L	probably benign	Het
Snrnp48	A	G	13: 38,211,105	T124A	probably benign	Het
Sptbn1	A	T	11: 30,138,637	M875K	possibly damaging	Het
Supt6	A	G	11: 78,222,198	V973A	possibly damaging	Het
Supv3l1	T	C	10: 62,443,383		probably benign	Het
Svep1	G	T	4: 58,068,740	N3015K	possibly damaging	Het
Tgfb3	A	G	12: 86,059,067		probably benign	Het
Trerf1	A	G	17: 47,317,845		noncoding transcript	Het
Trim24	T	A	6: 37,964,826	F904I	probably damaging	Het
Trim30d	T	A	7: 104,472,104	Y328F	probably benign	Het
Ttn	T	C	2: 76,868,373	E6G	probably damaging	Het
Ube2m	T	C	7: 13,035,835		probably benign	Het
Wdr90	A	T	17: 25,860,448	S237R	possibly damaging	Het
Zfp735	A	T	11: 73,712,333	H701L	possibly damaging	Het
Zp1	T	C	19: 10,918,878	D161G	probably benign	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	probably benign	0.00
R8504:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGTAAGGCAGAACCGAGCCTATCAG -3'
(R):5'- GCGCCACAGCCTAACTTTTATACCC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'

Posted On

2014-03-14