Incidental Mutation 'R1460:Scn2a'
ID162027
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Namesodium channel, voltage-gated, type II, alpha
SynonymsA230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission 039515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1460 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65620771-65767447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65701843 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 600 (T600A)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: T600A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: T600A

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: T600A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: T600A

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: T600A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: T600A

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.1494 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.1%
Validation Efficiency 94% (93/99)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A T 4: 109,531,210 probably null Het
Abcb11 A G 2: 69,257,374 probably benign Het
Abi3bp T C 16: 56,562,417 V130A probably damaging Het
Adamts4 A G 1: 171,256,440 probably benign Het
Adgrd1 A G 5: 129,122,563 T155A possibly damaging Het
Ano3 A T 2: 110,682,758 S631T probably damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Atg7 G A 6: 114,703,364 A384T probably damaging Het
Atp6v0a1 T A 11: 101,033,998 I303N probably damaging Het
B3gntl1 T G 11: 121,639,798 Y149S probably damaging Het
Btnl2 A G 17: 34,366,450 D475G probably benign Het
Cdcp1 A T 9: 123,180,027 S529T possibly damaging Het
Cenpt A G 8: 105,848,888 L194P probably damaging Het
Chmp4b A G 2: 154,692,595 D177G possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cish G T 9: 107,300,397 E91* probably null Het
Col22a1 T C 15: 71,821,931 D740G unknown Het
Crocc G A 4: 141,029,240 Q1025* probably null Het
Ctrc C A 4: 141,838,809 probably benign Het
Cyb5r2 T A 7: 107,757,243 D7V probably benign Het
Dhx29 T C 13: 112,965,210 probably benign Het
Dhx9 A C 1: 153,465,680 D607E probably benign Het
Dirc2 T C 16: 35,719,366 T362A probably benign Het
Dnajb7 C T 15: 81,407,687 G150R probably benign Het
Dnase1l3 T A 14: 7,974,050 T214S probably benign Het
Dpm1 A T 2: 168,210,629 I229N probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Entpd1 T C 19: 40,726,188 V247A probably damaging Het
Ephb3 C A 16: 21,218,922 H277Q probably benign Het
Etl4 A T 2: 20,788,477 N671I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160a1 T C 3: 85,730,876 I39V probably damaging Het
Fancd2os G A 6: 113,598,012 T11I probably damaging Het
Fcrlb G T 1: 170,912,284 probably benign Het
Gm4788 T A 1: 139,698,196 I788F probably damaging Het
Gm9268 A T 7: 43,023,215 R91S probably benign Het
Gm9991 T C 1: 90,679,058 noncoding transcript Het
Gstk1 C T 6: 42,246,595 R40W probably damaging Het
Gstt1 C T 10: 75,784,170 V190M probably damaging Het
Hectd2 G A 19: 36,615,508 W691* probably null Het
Hecw2 T C 1: 53,813,245 T1572A probably damaging Het
Hoxa5 T C 6: 52,203,948 T135A probably benign Het
Igfl3 T A 7: 18,179,955 C77S possibly damaging Het
Itgb4 A G 11: 115,984,164 D449G probably damaging Het
Larp1b T C 3: 40,962,218 V11A probably benign Het
Lhx9 A G 1: 138,838,709 probably benign Het
Lig3 G T 11: 82,795,798 probably benign Het
Lipo4 A C 19: 33,499,318 F343L probably benign Het
Lyn T A 4: 3,789,908 Y480* probably null Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mill1 C A 7: 18,262,670 A137D probably damaging Het
Morc2a A T 11: 3,683,794 R635S probably benign Het
Mpped2 A G 2: 106,744,892 probably benign Het
Mug2 T C 6: 122,040,533 probably benign Het
Mut T C 17: 40,937,375 Y98H probably damaging Het
Mynn C A 3: 30,603,704 S57Y probably damaging Het
Myo3b G A 2: 70,232,454 E333K probably benign Het
Myt1 A T 2: 181,802,932 I514F probably damaging Het
Nlrp4f A G 13: 65,190,268 C708R probably benign Het
Nod2 A G 8: 88,663,812 E249G probably damaging Het
Npy2r T C 3: 82,540,944 I175V probably benign Het
Obscn A T 11: 59,055,966 V4114D probably damaging Het
Olfr1249 A G 2: 89,629,938 probably null Het
Olfr1382 T A 11: 49,535,677 M164K possibly damaging Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr676 T A 7: 105,035,708 I170N possibly damaging Het
Olfr952 A G 9: 39,426,207 M288T probably benign Het
Pbxip1 T A 3: 89,445,614 I196N probably damaging Het
Piezo1 G A 8: 122,502,151 T209M possibly damaging Het
Polr1a T C 6: 71,941,384 M642T probably damaging Het
Prdm4 T C 10: 85,907,822 M190V probably benign Het
Psmd7 G A 8: 107,581,059 S264L possibly damaging Het
Qrich1 T G 9: 108,533,647 probably benign Het
Rapgef4 G T 2: 72,031,176 probably null Het
Rfx5 T C 3: 94,956,325 I95T probably damaging Het
Rgr G A 14: 37,045,726 R113C probably damaging Het
Rnf20 T C 4: 49,645,873 probably benign Het
Rps3a1 G A 3: 86,138,062 A241V probably benign Het
Rsg1 T C 4: 141,218,212 F125L probably damaging Het
Rttn A T 18: 89,109,357 probably benign Het
Scyl2 T C 10: 89,657,889 D339G possibly damaging Het
Sipa1 T A 19: 5,651,447 H1029L probably benign Het
Snrnp48 A G 13: 38,211,105 T124A probably benign Het
Sptbn1 A T 11: 30,138,637 M875K possibly damaging Het
Supt6 A G 11: 78,222,198 V973A possibly damaging Het
Supv3l1 T C 10: 62,443,383 probably benign Het
Svep1 G T 4: 58,068,740 N3015K possibly damaging Het
Tgfb3 A G 12: 86,059,067 probably benign Het
Trerf1 A G 17: 47,317,845 noncoding transcript Het
Trim24 T A 6: 37,964,826 F904I probably damaging Het
Trim30d T A 7: 104,472,104 Y328F probably benign Het
Ttn T C 2: 76,868,373 E6G probably damaging Het
Ube2m T C 7: 13,035,835 probably benign Het
Wdr90 A T 17: 25,860,448 S237R possibly damaging Het
Zfp735 A T 11: 73,712,333 H701L possibly damaging Het
Zp1 T C 19: 10,918,878 D161G probably benign Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
R8897:Scn2a UTSW 2 65715658 critical splice acceptor site probably null
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACCAGCGGGTCAAGCCATTTTC -3'
(R):5'- AATGGTCCTCACCTCTGGTAGTAGC -3'

Sequencing Primer
(F):5'- GGGTCAAGCCATTTTCTTCTG -3'
(R):5'- CAGAAGGGCCTCCAACTAGG -3'
Posted On2014-03-14