Incidental Mutation 'R1460:Ano3'
ID 162033
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 039515-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1460 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110682758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 631 (S631T)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: S631T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: S631T

Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.1%
Validation Efficiency 94% (93/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A T 4: 109,531,210 probably null Het
Abcb11 A G 2: 69,257,374 probably benign Het
Abi3bp T C 16: 56,562,417 V130A probably damaging Het
Adamts4 A G 1: 171,256,440 probably benign Het
Adgrd1 A G 5: 129,122,563 T155A possibly damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Atg7 G A 6: 114,703,364 A384T probably damaging Het
Atp6v0a1 T A 11: 101,033,998 I303N probably damaging Het
B3gntl1 T G 11: 121,639,798 Y149S probably damaging Het
Btnl2 A G 17: 34,366,450 D475G probably benign Het
Cdcp1 A T 9: 123,180,027 S529T possibly damaging Het
Cenpt A G 8: 105,848,888 L194P probably damaging Het
Chmp4b A G 2: 154,692,595 D177G possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cish G T 9: 107,300,397 E91* probably null Het
Col22a1 T C 15: 71,821,931 D740G unknown Het
Crocc G A 4: 141,029,240 Q1025* probably null Het
Ctrc C A 4: 141,838,809 probably benign Het
Cyb5r2 T A 7: 107,757,243 D7V probably benign Het
Dhx29 T C 13: 112,965,210 probably benign Het
Dhx9 A C 1: 153,465,680 D607E probably benign Het
Dirc2 T C 16: 35,719,366 T362A probably benign Het
Dnajb7 C T 15: 81,407,687 G150R probably benign Het
Dnase1l3 T A 14: 7,974,050 T214S probably benign Het
Dpm1 A T 2: 168,210,629 I229N probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Entpd1 T C 19: 40,726,188 V247A probably damaging Het
Ephb3 C A 16: 21,218,922 H277Q probably benign Het
Etl4 A T 2: 20,788,477 N671I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160a1 T C 3: 85,730,876 I39V probably damaging Het
Fancd2os G A 6: 113,598,012 T11I probably damaging Het
Fcrlb G T 1: 170,912,284 probably benign Het
Gm4788 T A 1: 139,698,196 I788F probably damaging Het
Gm9268 A T 7: 43,023,215 R91S probably benign Het
Gm9991 T C 1: 90,679,058 noncoding transcript Het
Gstk1 C T 6: 42,246,595 R40W probably damaging Het
Gstt1 C T 10: 75,784,170 V190M probably damaging Het
Hectd2 G A 19: 36,615,508 W691* probably null Het
Hecw2 T C 1: 53,813,245 T1572A probably damaging Het
Hoxa5 T C 6: 52,203,948 T135A probably benign Het
Igfl3 T A 7: 18,179,955 C77S possibly damaging Het
Itgb4 A G 11: 115,984,164 D449G probably damaging Het
Larp1b T C 3: 40,962,218 V11A probably benign Het
Lhx9 A G 1: 138,838,709 probably benign Het
Lig3 G T 11: 82,795,798 probably benign Het
Lipo4 A C 19: 33,499,318 F343L probably benign Het
Lyn T A 4: 3,789,908 Y480* probably null Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mill1 C A 7: 18,262,670 A137D probably damaging Het
Morc2a A T 11: 3,683,794 R635S probably benign Het
Mpped2 A G 2: 106,744,892 probably benign Het
Mug2 T C 6: 122,040,533 probably benign Het
Mut T C 17: 40,937,375 Y98H probably damaging Het
Mynn C A 3: 30,603,704 S57Y probably damaging Het
Myo3b G A 2: 70,232,454 E333K probably benign Het
Myt1 A T 2: 181,802,932 I514F probably damaging Het
Nlrp4f A G 13: 65,190,268 C708R probably benign Het
Nod2 A G 8: 88,663,812 E249G probably damaging Het
Npy2r T C 3: 82,540,944 I175V probably benign Het
Obscn A T 11: 59,055,966 V4114D probably damaging Het
Olfr1249 A G 2: 89,629,938 probably null Het
Olfr1382 T A 11: 49,535,677 M164K possibly damaging Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr676 T A 7: 105,035,708 I170N possibly damaging Het
Olfr952 A G 9: 39,426,207 M288T probably benign Het
Pbxip1 T A 3: 89,445,614 I196N probably damaging Het
Piezo1 G A 8: 122,502,151 T209M possibly damaging Het
Polr1a T C 6: 71,941,384 M642T probably damaging Het
Prdm4 T C 10: 85,907,822 M190V probably benign Het
Psmd7 G A 8: 107,581,059 S264L possibly damaging Het
Qrich1 T G 9: 108,533,647 probably benign Het
Rapgef4 G T 2: 72,031,176 probably null Het
Rfx5 T C 3: 94,956,325 I95T probably damaging Het
Rgr G A 14: 37,045,726 R113C probably damaging Het
Rnf20 T C 4: 49,645,873 probably benign Het
Rps3a1 G A 3: 86,138,062 A241V probably benign Het
Rsg1 T C 4: 141,218,212 F125L probably damaging Het
Rttn A T 18: 89,109,357 probably benign Het
Scn2a A G 2: 65,701,843 T600A probably damaging Het
Scyl2 T C 10: 89,657,889 D339G possibly damaging Het
Sipa1 T A 19: 5,651,447 H1029L probably benign Het
Snrnp48 A G 13: 38,211,105 T124A probably benign Het
Sptbn1 A T 11: 30,138,637 M875K possibly damaging Het
Supt6 A G 11: 78,222,198 V973A possibly damaging Het
Supv3l1 T C 10: 62,443,383 probably benign Het
Svep1 G T 4: 58,068,740 N3015K possibly damaging Het
Tgfb3 A G 12: 86,059,067 probably benign Het
Trerf1 A G 17: 47,317,845 noncoding transcript Het
Trim24 T A 6: 37,964,826 F904I probably damaging Het
Trim30d T A 7: 104,472,104 Y328F probably benign Het
Ttn T C 2: 76,868,373 E6G probably damaging Het
Ube2m T C 7: 13,035,835 probably benign Het
Wdr90 A T 17: 25,860,448 S237R possibly damaging Het
Zfp735 A T 11: 73,712,333 H701L possibly damaging Het
Zp1 T C 19: 10,918,878 D161G probably benign Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense not run
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaataacgcactggggac -3'
Posted On 2014-03-14