Mutagenetix > Incidental Mutations

Incidental Mutation 'R1460:Rnf20'

162046

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

039515-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1460 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 49645873 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably benign
Transcript: ENSMUST00000029989

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131962

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably benign
Transcript: ENSMUST00000156314

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167496

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.1%

Validation Efficiency

94% (93/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	T	4: 109,531,210		probably null	Het
Abcb11	A	G	2: 69,257,374		probably benign	Het
Abi3bp	T	C	16: 56,562,417	V130A	probably damaging	Het
Adamts4	A	G	1: 171,256,440		probably benign	Het
Adgrd1	A	G	5: 129,122,563	T155A	possibly damaging	Het
Ano3	A	T	2: 110,682,758	S631T	probably damaging	Het
Ass1	G	A	2: 31,514,741	V345I	probably benign	Het
Atg7	G	A	6: 114,703,364	A384T	probably damaging	Het
Atp6v0a1	T	A	11: 101,033,998	I303N	probably damaging	Het
B3gntl1	T	G	11: 121,639,798	Y149S	probably damaging	Het
Btnl2	A	G	17: 34,366,450	D475G	probably benign	Het
Cdcp1	A	T	9: 123,180,027	S529T	possibly damaging	Het
Cenpt	A	G	8: 105,848,888	L194P	probably damaging	Het
Chmp4b	A	G	2: 154,692,595	D177G	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cish	G	T	9: 107,300,397	E91*	probably null	Het
Col22a1	T	C	15: 71,821,931	D740G	unknown	Het
Crocc	G	A	4: 141,029,240	Q1025*	probably null	Het
Ctrc	C	A	4: 141,838,809		probably benign	Het
Cyb5r2	T	A	7: 107,757,243	D7V	probably benign	Het
Dhx29	T	C	13: 112,965,210		probably benign	Het
Dhx9	A	C	1: 153,465,680	D607E	probably benign	Het
Dirc2	T	C	16: 35,719,366	T362A	probably benign	Het
Dnajb7	C	T	15: 81,407,687	G150R	probably benign	Het
Dnase1l3	T	A	14: 7,974,050	T214S	probably benign	Het
Dpm1	A	T	2: 168,210,629	I229N	probably damaging	Het
Dstn	T	C	2: 143,938,488	V36A	possibly damaging	Het
Entpd1	T	C	19: 40,726,188	V247A	probably damaging	Het
Ephb3	C	A	16: 21,218,922	H277Q	probably benign	Het
Etl4	A	T	2: 20,788,477	N671I	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam160a1	T	C	3: 85,730,876	I39V	probably damaging	Het
Fancd2os	G	A	6: 113,598,012	T11I	probably damaging	Het
Fcrlb	G	T	1: 170,912,284		probably benign	Het
Gm4788	T	A	1: 139,698,196	I788F	probably damaging	Het
Gm9268	A	T	7: 43,023,215	R91S	probably benign	Het
Gm9991	T	C	1: 90,679,058		noncoding transcript	Het
Gstk1	C	T	6: 42,246,595	R40W	probably damaging	Het
Gstt1	C	T	10: 75,784,170	V190M	probably damaging	Het
Hectd2	G	A	19: 36,615,508	W691*	probably null	Het
Hecw2	T	C	1: 53,813,245	T1572A	probably damaging	Het
Hoxa5	T	C	6: 52,203,948	T135A	probably benign	Het
Igfl3	T	A	7: 18,179,955	C77S	possibly damaging	Het
Itgb4	A	G	11: 115,984,164	D449G	probably damaging	Het
Larp1b	T	C	3: 40,962,218	V11A	probably benign	Het
Lhx9	A	G	1: 138,838,709		probably benign	Het
Lig3	G	T	11: 82,795,798		probably benign	Het
Lipo4	A	C	19: 33,499,318	F343L	probably benign	Het
Lyn	T	A	4: 3,789,908	Y480*	probably null	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mill1	C	A	7: 18,262,670	A137D	probably damaging	Het
Morc2a	A	T	11: 3,683,794	R635S	probably benign	Het
Mpped2	A	G	2: 106,744,892		probably benign	Het
Mug2	T	C	6: 122,040,533		probably benign	Het
Mut	T	C	17: 40,937,375	Y98H	probably damaging	Het
Mynn	C	A	3: 30,603,704	S57Y	probably damaging	Het
Myo3b	G	A	2: 70,232,454	E333K	probably benign	Het
Myt1	A	T	2: 181,802,932	I514F	probably damaging	Het
Nlrp4f	A	G	13: 65,190,268	C708R	probably benign	Het
Nod2	A	G	8: 88,663,812	E249G	probably damaging	Het
Npy2r	T	C	3: 82,540,944	I175V	probably benign	Het
Obscn	A	T	11: 59,055,966	V4114D	probably damaging	Het
Olfr1249	A	G	2: 89,629,938		probably null	Het
Olfr1382	T	A	11: 49,535,677	M164K	possibly damaging	Het
Olfr355	A	T	2: 36,927,808	M102K	probably damaging	Het
Olfr676	T	A	7: 105,035,708	I170N	possibly damaging	Het
Olfr952	A	G	9: 39,426,207	M288T	probably benign	Het
Pbxip1	T	A	3: 89,445,614	I196N	probably damaging	Het
Piezo1	G	A	8: 122,502,151	T209M	possibly damaging	Het
Polr1a	T	C	6: 71,941,384	M642T	probably damaging	Het
Prdm4	T	C	10: 85,907,822	M190V	probably benign	Het
Psmd7	G	A	8: 107,581,059	S264L	possibly damaging	Het
Qrich1	T	G	9: 108,533,647		probably benign	Het
Rapgef4	G	T	2: 72,031,176		probably null	Het
Rfx5	T	C	3: 94,956,325	I95T	probably damaging	Het
Rgr	G	A	14: 37,045,726	R113C	probably damaging	Het
Rps3a1	G	A	3: 86,138,062	A241V	probably benign	Het
Rsg1	T	C	4: 141,218,212	F125L	probably damaging	Het
Rttn	A	T	18: 89,109,357		probably benign	Het
Scn2a	A	G	2: 65,701,843	T600A	probably damaging	Het
Scyl2	T	C	10: 89,657,889	D339G	possibly damaging	Het
Sipa1	T	A	19: 5,651,447	H1029L	probably benign	Het
Snrnp48	A	G	13: 38,211,105	T124A	probably benign	Het
Sptbn1	A	T	11: 30,138,637	M875K	possibly damaging	Het
Supt6	A	G	11: 78,222,198	V973A	possibly damaging	Het
Supv3l1	T	C	10: 62,443,383		probably benign	Het
Svep1	G	T	4: 58,068,740	N3015K	possibly damaging	Het
Tgfb3	A	G	12: 86,059,067		probably benign	Het
Trerf1	A	G	17: 47,317,845		noncoding transcript	Het
Trim24	T	A	6: 37,964,826	F904I	probably damaging	Het
Trim30d	T	A	7: 104,472,104	Y328F	probably benign	Het
Ttn	T	C	2: 76,868,373	E6G	probably damaging	Het
Ube2m	T	C	7: 13,035,835		probably benign	Het
Wdr90	A	T	17: 25,860,448	S237R	possibly damaging	Het
Zfp735	A	T	11: 73,712,333	H701L	possibly damaging	Het
Zp1	T	C	19: 10,918,878	D161G	probably benign	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTGCAGCCTCTCAGTAAAGAGTCC -3'
(R):5'- AGAGCTGTGCCTCCTACCTTCAAC -3'

Sequencing Primer
(F):5'- CCGGAAGGTAACATTTGCTC -3'
(R):5'- AACTTTTCATTCTGTGTAGTGACC -3'

Posted On

2014-03-14