Incidental Mutation 'R1450:Dennd4a'
ID 162157
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 039505-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.489) question?
Stock # R1450 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64818947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1701 (I1701V)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably benign
Transcript: ENSMUST00000038890
AA Change: I1701V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: I1701V

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217307
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,380,531 (GRCm39) probably benign Het
Adh4 C T 3: 138,129,935 (GRCm39) P254S probably damaging Het
Amfr T C 8: 94,714,375 (GRCm39) T223A probably benign Het
Ank2 T C 3: 126,750,951 (GRCm39) T412A possibly damaging Het
Bag6 T A 17: 35,360,934 (GRCm39) D422E probably benign Het
Ccdc185 T G 1: 182,575,129 (GRCm39) Q520P possibly damaging Het
Cfap276 T A 3: 108,449,799 (GRCm39) probably null Het
Clock G A 5: 76,410,578 (GRCm39) Q98* probably null Het
Cngb3 A T 4: 19,395,922 (GRCm39) probably benign Het
Csmd1 T G 8: 15,995,180 (GRCm39) probably null Het
Cubn A G 2: 13,365,130 (GRCm39) L1636P probably damaging Het
Dgcr2 T C 16: 17,674,678 (GRCm39) H243R possibly damaging Het
Dimt1 A G 13: 107,084,151 (GRCm39) N46S probably benign Het
Dnah9 T C 11: 65,818,612 (GRCm39) Y58C probably damaging Het
Dsg1b T A 18: 20,542,241 (GRCm39) V916E probably damaging Het
Dst T C 1: 34,227,476 (GRCm39) S1690P probably damaging Het
Dst T A 1: 34,251,340 (GRCm39) I2131K probably damaging Het
Epb41l1 T C 2: 156,353,745 (GRCm39) probably benign Het
Fem1a T C 17: 56,564,579 (GRCm39) V224A probably damaging Het
Got2 C T 8: 96,598,614 (GRCm39) E203K probably benign Het
Hcar2 A T 5: 124,002,813 (GRCm39) I230N probably damaging Het
Herc3 A T 6: 58,853,500 (GRCm39) K554* probably null Het
Hfm1 A G 5: 107,066,324 (GRCm39) F35L probably damaging Het
Hmcn1 A G 1: 150,528,257 (GRCm39) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hs2st1 C T 3: 144,140,479 (GRCm39) probably benign Het
Igfbp5 T A 1: 72,913,048 (GRCm39) D84V probably benign Het
Ints3 C A 3: 90,340,135 (GRCm39) L41F probably damaging Het
Ipo5 T C 14: 121,181,805 (GRCm39) V966A probably benign Het
Kif26a C T 12: 112,140,286 (GRCm39) T505M probably damaging Het
Kpna2 A G 11: 106,888,135 (GRCm39) S2P probably benign Het
Lct A G 1: 128,235,640 (GRCm39) S456P probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc7 T G 3: 157,892,681 (GRCm39) I323L possibly damaging Het
Ly6g A G 15: 75,030,482 (GRCm39) K77R probably benign Het
Maea T C 5: 33,523,144 (GRCm39) probably null Het
Marco A T 1: 120,404,474 (GRCm39) probably benign Het
Mcmbp G T 7: 128,317,655 (GRCm39) probably benign Het
Mtcl3 A T 10: 29,023,736 (GRCm39) N361I probably damaging Het
Mtr T A 13: 12,208,619 (GRCm39) R1017W probably damaging Het
Myo15a T A 11: 60,386,308 (GRCm39) I1811N probably damaging Het
Nbeal2 G A 9: 110,462,740 (GRCm39) probably benign Het
Nlrp10 A G 7: 108,524,595 (GRCm39) V295A probably damaging Het
Or10ak7 T C 4: 118,791,707 (GRCm39) T111A probably benign Het
Or51ac3 A G 7: 103,213,658 (GRCm39) V276A probably benign Het
Or5e1 A T 7: 108,354,719 (GRCm39) I219F probably damaging Het
Pde4b A T 4: 102,458,832 (GRCm39) Q496L probably damaging Het
Peg12 C A 7: 62,113,324 (GRCm39) G258* probably null Het
Pigc A G 1: 161,798,822 (GRCm39) Y268C probably benign Het
Pnisr G T 4: 21,874,912 (GRCm39) probably null Het
Poteg T C 8: 27,937,871 (GRCm39) F5S probably benign Het
Prss40 T A 1: 34,595,178 (GRCm39) I101F probably benign Het
Ptges3l T A 11: 101,312,731 (GRCm39) D113V possibly damaging Het
Raver2 T C 4: 100,993,349 (GRCm39) S510P possibly damaging Het
Rgr A T 14: 36,766,641 (GRCm39) C94* probably null Het
Rp1l1 T A 14: 64,265,599 (GRCm39) I395N probably benign Het
Sesn3 T A 9: 14,227,520 (GRCm39) H168Q possibly damaging Het
Sox30 C A 11: 45,908,098 (GRCm39) P755Q probably damaging Het
Stac3 T C 10: 127,340,754 (GRCm39) F173S probably damaging Het
Synj2 C A 17: 6,077,599 (GRCm39) probably benign Het
Tars3 A T 7: 65,297,244 (GRCm39) I120L probably benign Het
Tas2r124 A G 6: 132,732,019 (GRCm39) I109M probably damaging Het
Tm4sf19 A T 16: 32,226,781 (GRCm39) H190L probably damaging Het
Tmem143 T G 7: 45,556,532 (GRCm39) V179G probably damaging Het
Ubr4 T C 4: 139,195,339 (GRCm39) F1187S probably damaging Het
Ubtfl1 A G 9: 18,321,209 (GRCm39) R246G possibly damaging Het
Zdhhc5 A G 2: 84,532,733 (GRCm39) F57S probably damaging Het
Zfp40 A T 17: 23,394,232 (GRCm39) M717K probably benign Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAGAGAGCCTTAGCCTCTCG -3'
(R):5'- GAGTGCGGTTCTGACCTGTAAGAC -3'

Sequencing Primer
(F):5'- agtggtggatgtgggagag -3'
(R):5'- GTTCTGACCTGTAAGACAAAAAGC -3'
Posted On 2014-03-14