Mutagenetix > Incidental Mutation

Incidental Mutation 'R1450:Sox30'

162162

Institutional Source

Beutler Lab

Gene Symbol

Sox30

Ensembl Gene

ENSMUSG00000040489

Gene Name

SRY (sex determining region Y)-box 30

Synonyms

MMRRC Submission

039505-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45980310-46017994 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 46017271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 755 (P755Q)

Ref Sequence

ENSEMBL: ENSMUSP00000037519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049038]

AlphaFold

Q8CGW4

Predicted Effect

probably damaging
Transcript: ENSMUST00000049038
AA Change: P755Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: P755Q

Domain	Start	End	E-Value	Type
low complexity region	3	36	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
low complexity region	50	80	N/A	INTRINSIC
low complexity region	92	104	N/A	INTRINSIC
low complexity region	110	141	N/A	INTRINSIC
low complexity region	210	220	N/A	INTRINSIC
HMG	365	435	8.35e-24	SMART
low complexity region	523	539	N/A	INTRINSIC
Blast:Pept_C1	572	734	1e-92	BLAST

Meta Mutation Damage Score

0.0887

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.0%
20x: 84.8%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	T	A	3: 108,542,483		probably null	Het
Abca13	A	T	11: 9,430,531		probably benign	Het
Adh4	C	T	3: 138,424,174	P254S	probably damaging	Het
Amfr	T	C	8: 93,987,747	T223A	probably benign	Het
Ank2	T	C	3: 126,957,302	T412A	possibly damaging	Het
Bag6	T	A	17: 35,141,958	D422E	probably benign	Het
Ccdc185	T	G	1: 182,747,564	Q520P	possibly damaging	Het
Clock	G	A	5: 76,262,731	Q98*	probably null	Het
Cngb3	A	T	4: 19,395,922		probably benign	Het
Csmd1	T	G	8: 15,945,180		probably null	Het
Cubn	A	G	2: 13,360,319	L1636P	probably damaging	Het
Dennd4a	A	G	9: 64,911,665	I1701V	probably benign	Het
Dgcr2	T	C	16: 17,856,814	H243R	possibly damaging	Het
Dimt1	A	G	13: 106,947,643	N46S	probably benign	Het
Dnah9	T	C	11: 65,927,786	Y58C	probably damaging	Het
Dsg1b	T	A	18: 20,409,184	V916E	probably damaging	Het
Dst	T	C	1: 34,188,395	S1690P	probably damaging	Het
Dst	T	A	1: 34,212,259	I2131K	probably damaging	Het
Epb41l1	T	C	2: 156,511,825		probably benign	Het
Fem1a	T	C	17: 56,257,579	V224A	probably damaging	Het
Got2	C	T	8: 95,871,986	E203K	probably benign	Het
Hcar2	A	T	5: 123,864,750	I230N	probably damaging	Het
Herc3	A	T	6: 58,876,515	K554*	probably null	Het
Hfm1	A	G	5: 106,918,458	F35L	probably damaging	Het
Hmcn1	A	G	1: 150,652,506		probably benign	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Hs2st1	C	T	3: 144,434,718		probably benign	Het
Igfbp5	T	A	1: 72,873,889	D84V	probably benign	Het
Ints3	C	A	3: 90,432,828	L41F	probably damaging	Het
Ipo5	T	C	14: 120,944,393	V966A	probably benign	Het
Kif26a	C	T	12: 112,173,852	T505M	probably damaging	Het
Kpna2	A	G	11: 106,997,309	S2P	probably benign	Het
Lct	A	G	1: 128,307,903	S456P	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc7	T	G	3: 158,187,044	I323L	possibly damaging	Het
Ly6g	A	G	15: 75,158,633	K77R	probably benign	Het
Maea	T	C	5: 33,365,800		probably null	Het
Marco	A	T	1: 120,476,745		probably benign	Het
Mcmbp	G	T	7: 128,715,931		probably benign	Het
Mtr	T	A	13: 12,193,733	R1017W	probably damaging	Het
Myo15	T	A	11: 60,495,482	I1811N	probably damaging	Het
Nbeal2	G	A	9: 110,633,672		probably benign	Het
Nlrp10	A	G	7: 108,925,388	V295A	probably damaging	Het
Olfr1328	T	C	4: 118,934,510	T111A	probably benign	Het
Olfr513	A	T	7: 108,755,512	I219F	probably damaging	Het
Olfr616	A	G	7: 103,564,451	V276A	probably benign	Het
Pde4b	A	T	4: 102,601,635	Q496L	probably damaging	Het
Peg12	C	A	7: 62,463,576	G258*	probably null	Het
Pigc	A	G	1: 161,971,253	Y268C	probably benign	Het
Pnisr	G	T	4: 21,874,912		probably null	Het
Poteg	T	C	8: 27,447,843	F5S	probably benign	Het
Prss40	T	A	1: 34,556,097	I101F	probably benign	Het
Ptges3l	T	A	11: 101,421,905	D113V	possibly damaging	Het
Raver2	T	C	4: 101,136,152	S510P	possibly damaging	Het
Rgr	A	T	14: 37,044,684	C94*	probably null	Het
Rp1l1	T	A	14: 64,028,150	I395N	probably benign	Het
Sesn3	T	A	9: 14,316,224	H168Q	possibly damaging	Het
Soga3	A	T	10: 29,147,740	N361I	probably damaging	Het
Stac3	T	C	10: 127,504,885	F173S	probably damaging	Het
Synj2	C	A	17: 6,027,324		probably benign	Het
Tarsl2	A	T	7: 65,647,496	I120L	probably benign	Het
Tas2r124	A	G	6: 132,755,056	I109M	probably damaging	Het
Tm4sf19	A	T	16: 32,407,963	H190L	probably damaging	Het
Tmem143	T	G	7: 45,907,108	V179G	probably damaging	Het
Ubr4	T	C	4: 139,468,028	F1187S	probably damaging	Het
Ubtfl1	A	G	9: 18,409,913	R246G	possibly damaging	Het
Zdhhc5	A	G	2: 84,702,389	F57S	probably damaging	Het
Zfp40	A	T	17: 23,175,258	M717K	probably benign	Het

Other mutations in Sox30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Sox30	APN	11	45991900	missense	possibly damaging	0.95
IGL01449:Sox30	APN	11	45981342	missense	probably damaging	1.00
IGL02411:Sox30	APN	11	45981124	nonsense	probably null
IGL02601:Sox30	APN	11	45984762	missense	possibly damaging	0.81
IGL02747:Sox30	APN	11	45980945	missense	probably benign	0.00
IGL03403:Sox30	APN	11	46017208	missense	probably damaging	1.00
R0104:Sox30	UTSW	11	45981314	missense	possibly damaging	0.93
R2109:Sox30	UTSW	11	45991768	missense	probably damaging	0.99
R2213:Sox30	UTSW	11	45984852	missense	probably damaging	1.00
R3715:Sox30	UTSW	11	45984792	missense	probably damaging	0.99
R4111:Sox30	UTSW	11	46017214	missense	probably benign	0.09
R4723:Sox30	UTSW	11	45984765	missense	probably benign	0.03
R5014:Sox30	UTSW	11	45991909	missense	probably benign	0.01
R5408:Sox30	UTSW	11	45991867	missense	possibly damaging	0.54
R5974:Sox30	UTSW	11	45981073	missense	probably damaging	0.99
R6063:Sox30	UTSW	11	45991942	missense	probably benign	0.04
R6948:Sox30	UTSW	11	46017339	missense	probably damaging	1.00
R7242:Sox30	UTSW	11	45984520	splice site	probably null
R7258:Sox30	UTSW	11	45980552	missense	unknown
R8195:Sox30	UTSW	11	45991765	missense	probably benign	0.00
R9205:Sox30	UTSW	11	46017353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTTAACTCATAGTCTGTGGCCC -3'
(R):5'- ATGAACGGCACTTGGTCCTGACTC -3'

Sequencing Primer
(F):5'- TCCAAGTTCAATGCCAGAATGTC -3'
(R):5'- TCCTCAGATCATGGCTGAAAAC -3'

Posted On

2014-03-14