Incidental Mutation 'R1454:Adcy10'
ID 162182
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock # R1454 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 165515380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 272 (I272F)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect possibly damaging
Transcript: ENSMUST00000027852
AA Change: I272F

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: I272F

CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111439
AA Change: I272F

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: I272F

CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111440
AA Change: I272F

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: I272F

CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000148550
AA Change: I272F

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: I272F

CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
Bugged UTSW 1 165564237 missense probably damaging 0.99
debye UTSW 1 165551361 critical splice donor site probably null
malaysian UTSW 1 165513127 missense probably benign 0.38
singaporean UTSW 1 165518312 missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 splice site probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165546549 missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165503288 missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165510337 missense probably benign 0.34
R8812:Adcy10 UTSW 1 165551298 missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165518345 missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165575649 missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165543110 missense probably benign 0.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaactcccaaactaagaacaac -3'
Posted On 2014-03-14