Mutagenetix > Incidental Mutations

Incidental Mutation 'R1454:Dcaf17'

162184

Institutional Source

Beutler Lab

Gene Symbol

Dcaf17

Ensembl Gene

ENSMUSG00000041966

Gene Name

DDB1 and CUL4 associated factor 17

Synonyms

MMRRC Submission

039509-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.380) question?

Stock #

R1454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71055328-71099142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71073173 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 171 (N171D)

Ref Sequence

ENSEMBL: ENSMUSP00000120016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064141] [ENSMUST00000102701] [ENSMUST00000112159] [ENSMUST00000112167] [ENSMUST00000135357] [ENSMUST00000154704]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064141
AA Change: N171D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000102701
AA Change: N171D

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000112159
AA Change: N171D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000112167

Predicted Effect

unknown
Transcript: ENSMUST00000130292
AA Change: N185D

SMART Domains

Protein: ENSMUSP00000117830
Gene: ENSMUSG00000041966
AA Change: N185D

Domain	Start	End	E-Value	Type
Pfam:DCAF17	55	405	6.6e-166	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132619

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135357
AA Change: N84D

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118011
Gene: ENSMUSG00000041966
AA Change: N84D

Domain	Start	End	E-Value	Type
transmembrane domain	98	117	N/A	INTRINSIC
transmembrane domain	132	151	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136299

Predicted Effect

probably damaging
Transcript: ENSMUST00000154704
AA Change: N171D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.0639

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.2%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear transmembrane protein that associates with cullin 4A/damaged DNA binding protein 1 ubiquitin ligase complex. Mutations in this gene are associated with Woodhouse-Sakati syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,869,993	V537A	possibly damaging	Het
Adcy10	A	T	1: 165,515,380	I272F	possibly damaging	Het
Adcy6	A	G	15: 98,604,728	S2P	probably damaging	Het
Agap1	A	G	1: 89,837,806		probably null	Het
Aldh3a2	A	G	11: 61,265,102	V116A	probably benign	Het
Ankdd1b	A	T	13: 96,433,405		probably null	Het
Antxrl	G	A	14: 34,060,949	V233I	probably damaging	Het
Atp8b5	A	G	4: 43,302,590	I38V	probably benign	Het
Atxn7l2	A	G	3: 108,208,432		probably benign	Het
Bfsp2	A	T	9: 103,480,225	M1K	probably null	Het
Camsap3	T	A	8: 3,603,968	I520N	possibly damaging	Het
Cenpc1	C	T	5: 86,013,510	V854I	possibly damaging	Het
Csnk2a1	T	C	2: 152,257,427	L88S	probably damaging	Het
Dctn1	G	C	6: 83,197,508	A1077P	possibly damaging	Het
Dock1	T	C	7: 134,851,609		probably benign	Het
Egfr	A	T	11: 16,889,920	I645L	probably benign	Het
Gdpd1	T	G	11: 87,059,509	K79N	possibly damaging	Het
Ggt5	A	T	10: 75,609,908	L432F	probably benign	Het
Gm11060	A	G	2: 105,093,752	T22A	unknown	Het
Gpr132	G	A	12: 112,852,240	T322I	possibly damaging	Het
Grin1	G	A	2: 25,292,430	R940*	probably null	Het
Hip1	T	C	5: 135,438,632	T316A	probably benign	Het
Hnrnpm	A	G	17: 33,666,488		probably benign	Het
Hsd3b5	G	A	3: 98,619,530	T200I	probably benign	Het
Hspa9	A	T	18: 34,938,606	L647H	probably damaging	Het
Itgad	T	C	7: 128,192,137	I727T	probably benign	Het
Kcnma1	T	C	14: 23,463,200	D522G	probably damaging	Het
Lipf	C	T	19: 33,970,732		probably benign	Het
Ly6i	T	C	15: 74,983,055	D2G	possibly damaging	Het
Mast1	G	A	8: 84,920,635	P631L	probably damaging	Het
Mmp1b	G	C	9: 7,386,693	L144V	probably damaging	Het
Msh6	A	G	17: 87,984,758	S314G	probably benign	Het
Myo5c	G	A	9: 75,263,066	V493I	possibly damaging	Het
Nefm	A	G	14: 68,121,379	L402P	probably damaging	Het
Nrxn2	T	C	19: 6,481,446	F697S	probably damaging	Het
Olfr156	A	T	4: 43,820,639	C241S	probably damaging	Het
Pex13	A	G	11: 23,649,422	I363T	probably benign	Het
Plcb3	T	C	19: 6,955,046	R1082G	possibly damaging	Het
Psg28	A	T	7: 18,427,964	S205T	possibly damaging	Het
Pxt1	C	A	17: 28,934,782	V26L	possibly damaging	Het
Ripk2	G	A	4: 16,163,239	T53M	probably damaging	Het
Slc5a9	A	G	4: 111,883,964	V495A	probably benign	Het
Snrpa	T	C	7: 27,192,937	K66R	probably benign	Het
Srgap1	T	A	10: 121,896,738	E145V	probably damaging	Het
Suz12	A	G	11: 80,032,113	T694A	probably benign	Het
Tatdn2	T	A	6: 113,704,327	D440E	probably benign	Het
Tbc1d21	A	G	9: 58,362,813		probably null	Het
Tbc1d31	T	A	15: 57,951,638	Y570*	probably null	Het
Tbc1d32	A	T	10: 56,177,479		probably benign	Het
Tdrd5	G	C	1: 156,259,836	Q839E	probably benign	Het
Tecpr2	A	G	12: 110,968,953	N1402S	probably benign	Het
Thbs1	A	G	2: 118,122,672	D921G	probably damaging	Het
Tll1	A	G	8: 64,038,490	V803A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm4	T	C	7: 45,317,056	E461G	probably damaging	Het
Zp3	T	A	5: 135,984,188	I152N	probably damaging	Het

Other mutations in Dcaf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Dcaf17	APN	2	71078159	missense	probably benign	0.03
IGL01125:Dcaf17	APN	2	71089805	missense	probably benign	0.03
IGL01761:Dcaf17	APN	2	71056537	missense	probably damaging	1.00
IGL02641:Dcaf17	APN	2	71082031	missense	probably damaging	1.00
R0081:Dcaf17	UTSW	2	71078468	splice site	probably benign
R0388:Dcaf17	UTSW	2	71078571	missense	probably benign	0.02
R0593:Dcaf17	UTSW	2	71087400	critical splice donor site	probably null
R0637:Dcaf17	UTSW	2	71060419	missense	probably damaging	0.99
R0661:Dcaf17	UTSW	2	71088435	missense	probably damaging	1.00
R1281:Dcaf17	UTSW	2	71078156	missense	probably damaging	1.00
R1501:Dcaf17	UTSW	2	71081988	missense	probably damaging	1.00
R1908:Dcaf17	UTSW	2	71060369	nonsense	probably null
R1919:Dcaf17	UTSW	2	71078172	splice site	probably null
R2882:Dcaf17	UTSW	2	71082027	missense	possibly damaging	0.96
R4585:Dcaf17	UTSW	2	71088580	missense	probably benign	0.00
R4586:Dcaf17	UTSW	2	71088580	missense	probably benign	0.00
R6093:Dcaf17	UTSW	2	71082012	missense	possibly damaging	0.51
R7070:Dcaf17	UTSW	2	71088513	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AATAGCACAccaagcatggtggtt -3'
(R):5'- AGCACTAGAGCACTGTAGGCAGAC -3'

Sequencing Primer
(F):5'- cagcaagttcagcattagcc -3'
(R):5'- GCAGACATGGATCAATGATCTC -3'

Posted On

2014-03-14