Incidental Mutation 'R1454:Hsd3b5'
ID162188
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms3(beta)HSDV
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98618634-98630252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98619530 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 200 (T200I)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
Predicted Effect probably benign
Transcript: ENSMUST00000044094
AA Change: T200I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: T200I

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98630057 missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98630098 missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98619123 missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98622159 missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98630105 missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98622027 missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98622131 missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98619144 missense probably benign
R0624:Hsd3b5 UTSW 3 98619404 missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98619539 missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98619355 missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98630077 missense probably benign 0.00
R1631:Hsd3b5 UTSW 3 98622077 missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98619720 missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98619728 missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98619212 missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98619800 missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98622059 missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98619648 missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98619063 missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98619276 missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98619150 missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98630090 missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98622012 missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98619769 missense probably damaging 0.97
R7339:Hsd3b5 UTSW 3 98622074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAACTGGACGTAGCAGGAAGCTC -3'
(R):5'- GCATCGTGAAAGCACATGGCCTAAC -3'

Sequencing Primer
(F):5'- AGCTCACAGTTTCCAGCAGG -3'
(R):5'- GCACATGGCCTAACCCATAC -3'
Posted On2014-03-14