Incidental Mutation 'R1454:Mast1'
ID162206
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Namemicrotubule associated serine/threonine kinase 1
SynonymsSAST170, SAST, 9430008B02Rik
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1454 (G1)
Quality Score90
Status Validated
Chromosome8
Chromosomal Location84911903-84937359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84920635 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 631 (P631L)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]
Predicted Effect probably damaging
Transcript: ENSMUST00000109741
AA Change: P631L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: P631L

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119820
AA Change: P631L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: P631L

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175085
Meta Mutation Damage Score 0.676 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 84912815 missense possibly damaging 0.87
IGL01862:Mast1 APN 8 84913246 intron probably null
IGL01918:Mast1 APN 8 84921209 missense probably damaging 1.00
IGL02212:Mast1 APN 8 84921397 missense probably damaging 1.00
IGL02221:Mast1 APN 8 84918755 missense possibly damaging 0.92
IGL02370:Mast1 APN 8 84912254 missense probably benign
IGL02470:Mast1 APN 8 84921212 missense probably damaging 1.00
IGL02596:Mast1 APN 8 84917771 missense probably benign
IGL02716:Mast1 APN 8 84935723 missense probably damaging 1.00
IGL02987:Mast1 APN 8 84925719 missense possibly damaging 0.75
IGL03287:Mast1 APN 8 84913353 missense probably benign 0.01
R0255:Mast1 UTSW 8 84912021 missense probably benign
R0388:Mast1 UTSW 8 84915537 missense probably benign 0.13
R0480:Mast1 UTSW 8 84913089 missense probably damaging 0.99
R0727:Mast1 UTSW 8 84921415 missense probably damaging 1.00
R1175:Mast1 UTSW 8 84925327 missense probably benign 0.29
R1297:Mast1 UTSW 8 84912716 missense probably benign 0.05
R1328:Mast1 UTSW 8 84917988 intron probably benign
R1532:Mast1 UTSW 8 84928609 nonsense probably null
R1752:Mast1 UTSW 8 84925336 missense probably benign
R1777:Mast1 UTSW 8 84912068 missense probably benign
R1905:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1906:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1907:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R2056:Mast1 UTSW 8 84920366 missense possibly damaging 0.95
R2071:Mast1 UTSW 8 84921194 missense probably damaging 1.00
R2145:Mast1 UTSW 8 84921478 missense probably damaging 1.00
R2318:Mast1 UTSW 8 84921125 missense probably damaging 1.00
R2842:Mast1 UTSW 8 84923908 missense probably damaging 1.00
R3870:Mast1 UTSW 8 84918731 missense probably damaging 1.00
R3895:Mast1 UTSW 8 84935723 missense probably damaging 1.00
R3973:Mast1 UTSW 8 84918764 missense probably damaging 1.00
R4405:Mast1 UTSW 8 84920891 missense probably damaging 1.00
R4533:Mast1 UTSW 8 84921361 missense probably damaging 1.00
R4725:Mast1 UTSW 8 84929006 missense possibly damaging 0.93
R4770:Mast1 UTSW 8 84929246 missense probably benign 0.02
R4776:Mast1 UTSW 8 84937193 critical splice donor site probably null
R4835:Mast1 UTSW 8 84923779 missense probably damaging 1.00
R4871:Mast1 UTSW 8 84920658 missense probably damaging 1.00
R4953:Mast1 UTSW 8 84918728 missense probably damaging 0.99
R4960:Mast1 UTSW 8 84917871 missense probably benign
R4978:Mast1 UTSW 8 84935787 missense probably damaging 0.98
R5164:Mast1 UTSW 8 84913518 unclassified probably benign
R5235:Mast1 UTSW 8 84913439 missense probably damaging 1.00
R5297:Mast1 UTSW 8 84913318 critical splice donor site probably null
R5463:Mast1 UTSW 8 84925507 missense probably damaging 1.00
R5546:Mast1 UTSW 8 84916260 missense probably damaging 1.00
R5651:Mast1 UTSW 8 84928968 nonsense probably null
R6124:Mast1 UTSW 8 84925307 missense probably benign 0.01
R6213:Mast1 UTSW 8 84915569 missense probably damaging 1.00
R6717:Mast1 UTSW 8 84917754 missense probably benign
R7000:Mast1 UTSW 8 84928969 missense probably damaging 1.00
R7011:Mast1 UTSW 8 84911945 nonsense probably null
R7164:Mast1 UTSW 8 84935304 missense possibly damaging 0.81
X0066:Mast1 UTSW 8 84920878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGAAGAAACTATGCTGCTTCACC -3'
(R):5'- TGGGCTATGGGGATCATTCTCTACG -3'

Sequencing Primer
(F):5'- CTATGCTGCTTCACCTCAAAAG -3'
(R):5'- AGCTCTTTGGACAGGTCATCAG -3'
Posted On2014-03-14