Mutagenetix > Incidental Mutation

Incidental Mutation 'R1454:Tbc1d32'

162211

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

039509-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R1454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 56177479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

AlphaFold

Q3URV1

Predicted Effect

probably benign
Transcript: ENSMUST00000099739

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219385

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.2%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,869,993	V537A	possibly damaging	Het
Adcy10	A	T	1: 165,515,380	I272F	possibly damaging	Het
Adcy6	A	G	15: 98,604,728	S2P	probably damaging	Het
Agap1	A	G	1: 89,837,806		probably null	Het
Aldh3a2	A	G	11: 61,265,102	V116A	probably benign	Het
Ankdd1b	A	T	13: 96,433,405		probably null	Het
Antxrl	G	A	14: 34,060,949	V233I	probably damaging	Het
Atp8b5	A	G	4: 43,302,590	I38V	probably benign	Het
Atxn7l2	A	G	3: 108,208,432		probably benign	Het
Bfsp2	A	T	9: 103,480,225	M1K	probably null	Het
Camsap3	T	A	8: 3,603,968	I520N	possibly damaging	Het
Cenpc1	C	T	5: 86,013,510	V854I	possibly damaging	Het
Csnk2a1	T	C	2: 152,257,427	L88S	probably damaging	Het
Dcaf17	A	G	2: 71,073,173	N171D	probably damaging	Het
Dctn1	G	C	6: 83,197,508	A1077P	possibly damaging	Het
Dock1	T	C	7: 134,851,609		probably benign	Het
Egfr	A	T	11: 16,889,920	I645L	probably benign	Het
Gdpd1	T	G	11: 87,059,509	K79N	possibly damaging	Het
Ggt5	A	T	10: 75,609,908	L432F	probably benign	Het
Gm11060	A	G	2: 105,093,752	T22A	unknown	Het
Gpr132	G	A	12: 112,852,240	T322I	possibly damaging	Het
Grin1	G	A	2: 25,292,430	R940*	probably null	Het
Hip1	T	C	5: 135,438,632	T316A	probably benign	Het
Hnrnpm	A	G	17: 33,666,488		probably benign	Het
Hsd3b5	G	A	3: 98,619,530	T200I	probably benign	Het
Hspa9	A	T	18: 34,938,606	L647H	probably damaging	Het
Itgad	T	C	7: 128,192,137	I727T	probably benign	Het
Kcnma1	T	C	14: 23,463,200	D522G	probably damaging	Het
Lipf	C	T	19: 33,970,732		probably benign	Het
Ly6i	T	C	15: 74,983,055	D2G	possibly damaging	Het
Mast1	G	A	8: 84,920,635	P631L	probably damaging	Het
Mmp1b	G	C	9: 7,386,693	L144V	probably damaging	Het
Msh6	A	G	17: 87,984,758	S314G	probably benign	Het
Myo5c	G	A	9: 75,263,066	V493I	possibly damaging	Het
Nefm	A	G	14: 68,121,379	L402P	probably damaging	Het
Nrxn2	T	C	19: 6,481,446	F697S	probably damaging	Het
Olfr156	A	T	4: 43,820,639	C241S	probably damaging	Het
Pex13	A	G	11: 23,649,422	I363T	probably benign	Het
Plcb3	T	C	19: 6,955,046	R1082G	possibly damaging	Het
Psg28	A	T	7: 18,427,964	S205T	possibly damaging	Het
Pxt1	C	A	17: 28,934,782	V26L	possibly damaging	Het
Ripk2	G	A	4: 16,163,239	T53M	probably damaging	Het
Slc5a9	A	G	4: 111,883,964	V495A	probably benign	Het
Snrpa	T	C	7: 27,192,937	K66R	probably benign	Het
Srgap1	T	A	10: 121,896,738	E145V	probably damaging	Het
Suz12	A	G	11: 80,032,113	T694A	probably benign	Het
Tatdn2	T	A	6: 113,704,327	D440E	probably benign	Het
Tbc1d21	A	G	9: 58,362,813		probably null	Het
Tbc1d31	T	A	15: 57,951,638	Y570*	probably null	Het
Tdrd5	G	C	1: 156,259,836	Q839E	probably benign	Het
Tecpr2	A	G	12: 110,968,953	N1402S	probably benign	Het
Thbs1	A	G	2: 118,122,672	D921G	probably damaging	Het
Tll1	A	G	8: 64,038,490	V803A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm4	T	C	7: 45,317,056	E461G	probably damaging	Het
Zp3	T	A	5: 135,984,188	I152N	probably damaging	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
R8864:Tbc1d32	UTSW	10	56087559	missense	probably benign	0.01
R9018:Tbc1d32	UTSW	10	56072597	missense	probably benign	0.02
R9030:Tbc1d32	UTSW	10	56161145	missense	possibly damaging	0.92
R9530:Tbc1d32	UTSW	10	56196411	missense	probably damaging	0.98
R9616:Tbc1d32	UTSW	10	56161150	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACGCAGAGTCTTAAACCCGTTTACC -3'
(R):5'- TGGCAGAACTGTGCCTGAACATATC -3'

Sequencing Primer
(F):5'- AGTCTTAAACCCGTTTACCAAAATAG -3'
(R):5'- GGATGTTAGCTGCCCATCAAC -3'

Posted On

2014-03-14