Mutagenetix > Incidental Mutations

Incidental Mutation 'R1454:Tecpr2'

162219

Institutional Source

Beutler Lab

Gene Symbol

Tecpr2

Ensembl Gene

ENSMUSG00000021275

Gene Name

tectonin beta-propeller repeat containing 2

Synonyms

MMRRC Submission

039509-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1454 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

110889264-110972394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110968953 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1402 (N1402S)

Ref Sequence

ENSEMBL: ENSMUSP00000126749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]

Predicted Effect

probably benign
Transcript: ENSMUST00000165978
AA Change: N1402S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: N1402S

Domain	Start	End	E-Value	Type
WD40	21	61	8.52e1	SMART
WD40	65	105	2.54e2	SMART
WD40	113	155	2.49e-1	SMART
TECPR	280	314	9.81e0	SMART
TECPR	316	353	2.55e0	SMART
low complexity region	392	424	N/A	INTRINSIC
low complexity region	464	471	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	655	670	N/A	INTRINSIC
TECPR	814	850	2.28e2	SMART
TECPR	898	931	1.79e-1	SMART
TECPR	939	974	5.61e-3	SMART
TECPR	985	1023	1.55e-5	SMART
TECPR	1173	1208	1.29e-2	SMART
TECPR	1216	1255	2.82e-8	SMART
TECPR	1266	1308	1.05e-7	SMART
TECPR	1317	1351	1.42e-4	SMART
TECPR	1360	1394	5.03e-5	SMART
low complexity region	1414	1421	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169597
AA Change: N1402S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: N1402S

Domain	Start	End	E-Value	Type
WD40	21	61	8.52e1	SMART
WD40	65	105	2.54e2	SMART
WD40	113	155	2.49e-1	SMART
TECPR	280	314	9.81e0	SMART
TECPR	316	353	2.55e0	SMART
low complexity region	392	424	N/A	INTRINSIC
low complexity region	464	471	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	655	670	N/A	INTRINSIC
TECPR	814	850	2.28e2	SMART
TECPR	898	931	1.79e-1	SMART
TECPR	939	974	5.61e-3	SMART
TECPR	985	1023	1.55e-5	SMART
TECPR	1173	1208	1.29e-2	SMART
TECPR	1216	1255	2.82e-8	SMART
TECPR	1266	1308	1.05e-7	SMART
TECPR	1317	1351	1.42e-4	SMART
TECPR	1360	1394	5.03e-5	SMART
low complexity region	1414	1421	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223210

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.2%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,869,993	V537A	possibly damaging	Het
Adcy10	A	T	1: 165,515,380	I272F	possibly damaging	Het
Adcy6	A	G	15: 98,604,728	S2P	probably damaging	Het
Agap1	A	G	1: 89,837,806		probably null	Het
Aldh3a2	A	G	11: 61,265,102	V116A	probably benign	Het
Ankdd1b	A	T	13: 96,433,405		probably null	Het
Antxrl	G	A	14: 34,060,949	V233I	probably damaging	Het
Atp8b5	A	G	4: 43,302,590	I38V	probably benign	Het
Atxn7l2	A	G	3: 108,208,432		probably benign	Het
Bfsp2	A	T	9: 103,480,225	M1K	probably null	Het
Camsap3	T	A	8: 3,603,968	I520N	possibly damaging	Het
Cenpc1	C	T	5: 86,013,510	V854I	possibly damaging	Het
Csnk2a1	T	C	2: 152,257,427	L88S	probably damaging	Het
Dcaf17	A	G	2: 71,073,173	N171D	probably damaging	Het
Dctn1	G	C	6: 83,197,508	A1077P	possibly damaging	Het
Dock1	T	C	7: 134,851,609		probably benign	Het
Egfr	A	T	11: 16,889,920	I645L	probably benign	Het
Gdpd1	T	G	11: 87,059,509	K79N	possibly damaging	Het
Ggt5	A	T	10: 75,609,908	L432F	probably benign	Het
Gm11060	A	G	2: 105,093,752	T22A	unknown	Het
Gpr132	G	A	12: 112,852,240	T322I	possibly damaging	Het
Grin1	G	A	2: 25,292,430	R940*	probably null	Het
Hip1	T	C	5: 135,438,632	T316A	probably benign	Het
Hnrnpm	A	G	17: 33,666,488		probably benign	Het
Hsd3b5	G	A	3: 98,619,530	T200I	probably benign	Het
Hspa9	A	T	18: 34,938,606	L647H	probably damaging	Het
Itgad	T	C	7: 128,192,137	I727T	probably benign	Het
Kcnma1	T	C	14: 23,463,200	D522G	probably damaging	Het
Lipf	C	T	19: 33,970,732		probably benign	Het
Ly6i	T	C	15: 74,983,055	D2G	possibly damaging	Het
Mast1	G	A	8: 84,920,635	P631L	probably damaging	Het
Mmp1b	G	C	9: 7,386,693	L144V	probably damaging	Het
Msh6	A	G	17: 87,984,758	S314G	probably benign	Het
Myo5c	G	A	9: 75,263,066	V493I	possibly damaging	Het
Nefm	A	G	14: 68,121,379	L402P	probably damaging	Het
Nrxn2	T	C	19: 6,481,446	F697S	probably damaging	Het
Olfr156	A	T	4: 43,820,639	C241S	probably damaging	Het
Pex13	A	G	11: 23,649,422	I363T	probably benign	Het
Plcb3	T	C	19: 6,955,046	R1082G	possibly damaging	Het
Psg28	A	T	7: 18,427,964	S205T	possibly damaging	Het
Pxt1	C	A	17: 28,934,782	V26L	possibly damaging	Het
Ripk2	G	A	4: 16,163,239	T53M	probably damaging	Het
Slc5a9	A	G	4: 111,883,964	V495A	probably benign	Het
Snrpa	T	C	7: 27,192,937	K66R	probably benign	Het
Srgap1	T	A	10: 121,896,738	E145V	probably damaging	Het
Suz12	A	G	11: 80,032,113	T694A	probably benign	Het
Tatdn2	T	A	6: 113,704,327	D440E	probably benign	Het
Tbc1d21	A	G	9: 58,362,813		probably null	Het
Tbc1d31	T	A	15: 57,951,638	Y570*	probably null	Het
Tbc1d32	A	T	10: 56,177,479		probably benign	Het
Tdrd5	G	C	1: 156,259,836	Q839E	probably benign	Het
Thbs1	A	G	2: 118,122,672	D921G	probably damaging	Het
Tll1	A	G	8: 64,038,490	V803A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm4	T	C	7: 45,317,056	E461G	probably damaging	Het
Zp3	T	A	5: 135,984,188	I152N	probably damaging	Het

Other mutations in Tecpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Tecpr2	APN	12	110967779	missense	possibly damaging	0.67
IGL01759:Tecpr2	APN	12	110931392	utr 3 prime	probably benign
IGL02114:Tecpr2	APN	12	110968887	missense	probably damaging	1.00
IGL02813:Tecpr2	APN	12	110933192	missense	probably damaging	1.00
IGL02943:Tecpr2	APN	12	110967749	missense	probably benign
IGL03085:Tecpr2	APN	12	110954826	splice site	probably benign
IGL03290:Tecpr2	APN	12	110967833	missense	possibly damaging	0.65
R0362:Tecpr2	UTSW	12	110968940	missense	probably damaging	0.96
R0486:Tecpr2	UTSW	12	110896369	missense	probably benign	0.01
R0662:Tecpr2	UTSW	12	110896228	missense	probably benign	0.02
R0787:Tecpr2	UTSW	12	110946343	missense	probably benign	0.30
R1147:Tecpr2	UTSW	12	110941438	splice site	probably benign
R1513:Tecpr2	UTSW	12	110954800	missense	possibly damaging	0.94
R1567:Tecpr2	UTSW	12	110941596	critical splice donor site	probably null
R1569:Tecpr2	UTSW	12	110944887	critical splice donor site	probably null
R1818:Tecpr2	UTSW	12	110926454	missense	probably damaging	1.00
R1856:Tecpr2	UTSW	12	110933064	missense	probably benign
R1897:Tecpr2	UTSW	12	110933247	missense	probably benign
R1903:Tecpr2	UTSW	12	110947912	missense	probably damaging	0.98
R1939:Tecpr2	UTSW	12	110933169	missense	probably damaging	0.98
R1982:Tecpr2	UTSW	12	110954785	missense	probably benign	0.07
R2073:Tecpr2	UTSW	12	110968429	missense	possibly damaging	0.51
R2393:Tecpr2	UTSW	12	110926402	missense	probably damaging	0.99
R2443:Tecpr2	UTSW	12	110896325	missense	probably damaging	1.00
R2484:Tecpr2	UTSW	12	110933318	missense	probably benign
R4564:Tecpr2	UTSW	12	110954785	missense	probably benign	0.07
R4723:Tecpr2	UTSW	12	110932976	missense	probably benign	0.01
R4835:Tecpr2	UTSW	12	110954730	missense	probably benign	0.00
R4847:Tecpr2	UTSW	12	110939877	missense	probably damaging	1.00
R4911:Tecpr2	UTSW	12	110931487	missense	possibly damaging	0.74
R5179:Tecpr2	UTSW	12	110944693	missense	possibly damaging	0.63
R5266:Tecpr2	UTSW	12	110915402	missense	probably damaging	1.00
R5386:Tecpr2	UTSW	12	110915453	missense	probably damaging	1.00
R5486:Tecpr2	UTSW	12	110933015	missense	probably benign	0.03
R5490:Tecpr2	UTSW	12	110914684	missense	probably damaging	1.00
R5627:Tecpr2	UTSW	12	110941482	missense	probably damaging	0.97
R5836:Tecpr2	UTSW	12	110931511	missense	possibly damaging	0.76
R6052:Tecpr2	UTSW	12	110918891	missense	possibly damaging	0.89
R6084:Tecpr2	UTSW	12	110929109	missense	probably damaging	0.98
R6306:Tecpr2	UTSW	12	110944751	missense	probably damaging	1.00
R6563:Tecpr2	UTSW	12	110929087	missense	probably benign	0.00
R6936:Tecpr2	UTSW	12	110944863	missense	possibly damaging	0.83
R6977:Tecpr2	UTSW	12	110939766	missense	probably benign	0.17
R7110:Tecpr2	UTSW	12	110918972	missense	probably damaging	1.00
R7132:Tecpr2	UTSW	12	110915372	missense	probably damaging	0.97
R7353:Tecpr2	UTSW	12	110967844	missense	probably benign	0.06
R7362:Tecpr2	UTSW	12	110941476	missense	possibly damaging	0.85
R7366:Tecpr2	UTSW	12	110915480	critical splice donor site	probably null
R7404:Tecpr2	UTSW	12	110931604	missense	probably benign	0.00
R7478:Tecpr2	UTSW	12	110968439	missense	probably benign	0.36
R7774:Tecpr2	UTSW	12	110933172	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGTAGAGATGAACGGCCAGCTCC -3'
(R):5'- AACAGTTCCGAGAACGTGGCTAAG -3'

Sequencing Primer
(F):5'- CTCCTCATCCCTGAGCCATAATG -3'
(R):5'- GTGAGTTCTGTAATGAGACCAAAAC -3'

Posted On

2014-03-14