Incidental Mutation 'R1454:Antxrl'
ID162223
Institutional Source Beutler Lab
Gene Symbol Antxrl
Ensembl Gene ENSMUSG00000047441
Gene Nameanthrax toxin receptor-like
Synonyms
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34052707-34076405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34060949 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 233 (V233I)
Ref Sequence ENSEMBL: ENSMUSP00000052816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058725] [ENSMUST00000178958] [ENSMUST00000226211]
Predicted Effect probably damaging
Transcript: ENSMUST00000058725
AA Change: V233I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052816
Gene: ENSMUSG00000047441
AA Change: V233I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 74 248 2.9e-19 SMART
Pfam:Anth_Ig 249 351 6.7e-41 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 392 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Predicted Effect probably benign
Transcript: ENSMUST00000226211
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Antxrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Antxrl APN 14 34075597 missense probably benign 0.01
IGL01632:Antxrl APN 14 34067947 missense probably damaging 0.99
IGL02379:Antxrl APN 14 34056535 splice site probably null
IGL02381:Antxrl APN 14 34056611 unclassified probably null
IGL02736:Antxrl APN 14 34056618 unclassified probably benign
R0631:Antxrl UTSW 14 34058801 critical splice donor site probably null
R1190:Antxrl UTSW 14 34069250 missense probably benign 0.00
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1469:Antxrl UTSW 14 34067431 intron probably benign
R1638:Antxrl UTSW 14 34070496 critical splice donor site probably null
R1996:Antxrl UTSW 14 34075829 missense probably benign 0.01
R2174:Antxrl UTSW 14 34060400 missense probably damaging 1.00
R2421:Antxrl UTSW 14 34071689 intron probably benign
R3850:Antxrl UTSW 14 34067381 missense probably benign 0.00
R4178:Antxrl UTSW 14 34054971 unclassified probably null
R4434:Antxrl UTSW 14 34071617 intron probably benign
R4603:Antxrl UTSW 14 34075835 missense possibly damaging 0.72
R4769:Antxrl UTSW 14 34073070 missense possibly damaging 0.53
R6003:Antxrl UTSW 14 34075635 missense possibly damaging 0.72
R6047:Antxrl UTSW 14 34053476 intron probably benign
R6228:Antxrl UTSW 14 34056599 missense probably damaging 1.00
R6363:Antxrl UTSW 14 34069287 missense probably damaging 1.00
R6525:Antxrl UTSW 14 34060406 missense probably damaging 1.00
R6800:Antxrl UTSW 14 34065907 missense probably damaging 1.00
R6933:Antxrl UTSW 14 34075771 missense possibly damaging 0.53
R7086:Antxrl UTSW 14 34065916 missense probably benign 0.26
R7257:Antxrl UTSW 14 34065849 missense probably benign 0.03
R7315:Antxrl UTSW 14 34071547 missense unknown
X0028:Antxrl UTSW 14 34053915 critical splice donor site probably null
Z1088:Antxrl UTSW 14 34067971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCGAACCCCTTATGCAGAGTG -3'
(R):5'- TGCACAAACGTAGGTAGGCTGCAC -3'

Sequencing Primer
(F):5'- GGCCAGAGAGTTTCCCATTC -3'
(R):5'- Tgagagagagagagagagagagag -3'
Posted On2014-03-14