Incidental Mutation 'R1454:Trappc9'
ID162226
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1454 (G1)
Quality Score184
Status Validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73025967 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 377 (R377W)
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GGCAAGCATCTCACAAGTGACAAAG -3'
(R):5'- TTGTGCCCGTTAAGACAGACCCTC -3'

Sequencing Primer
(F):5'- caaatcccagcaaccacac -3'
(R):5'- TCGGAAATAGCTTTCCCCGAG -3'
Posted On2014-03-14