Incidental Mutation 'R1454:Hnrnpm'
ID 162232
Institutional Source Beutler Lab
Gene Symbol Hnrnpm
Ensembl Gene ENSMUSG00000059208
Gene Name heterogeneous nuclear ribonucleoprotein M
Synonyms Hnrpm, 2610023M21Rik
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1454 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 33646233-33686860 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 33666488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000139302] [ENSMUST00000148178]
AlphaFold Q9D0E1
Predicted Effect probably benign
Transcript: ENSMUST00000087582
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114385
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000139302
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000148178
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148258
SMART Domains Protein: ENSMUSP00000123580
Gene: ENSMUSG00000059208

DomainStartEndE-ValueType
RRM 21 93 1.66e-20 SMART
low complexity region 113 130 N/A INTRINSIC
low complexity region 146 167 N/A INTRINSIC
low complexity region 196 202 N/A INTRINSIC
internal_repeat_1 206 227 9.85e-5 PROSPERO
internal_repeat_1 221 238 9.85e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153608
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Hnrnpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00869:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00870:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00886:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00898:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00900:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00901:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00905:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00907:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00908:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00911:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00912:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00920:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00921:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00922:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00923:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00924:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00926:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00927:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00928:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00929:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00930:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00931:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00932:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00935:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00938:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00945:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00950:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00952:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00953:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00954:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00955:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00956:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00957:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00958:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00959:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00960:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL01301:Hnrnpm APN 17 33669168 critical splice donor site probably null
IGL02152:Hnrnpm APN 17 33658412 missense probably damaging 1.00
IGL02319:Hnrnpm APN 17 33649950 missense probably damaging 0.98
IGL02487:Hnrnpm APN 17 33648813 missense probably damaging 1.00
IGL03099:Hnrnpm APN 17 33669172 missense probably damaging 1.00
ANU18:Hnrnpm UTSW 17 33669168 critical splice donor site probably null
E0370:Hnrnpm UTSW 17 33658922 splice site probably benign
R0153:Hnrnpm UTSW 17 33646515 missense probably damaging 0.99
R0254:Hnrnpm UTSW 17 33652268 splice site probably null
R0606:Hnrnpm UTSW 17 33658390 missense probably damaging 0.97
R0940:Hnrnpm UTSW 17 33650002 missense probably damaging 1.00
R1216:Hnrnpm UTSW 17 33649713 missense probably damaging 0.99
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R2011:Hnrnpm UTSW 17 33664624 missense probably damaging 1.00
R4678:Hnrnpm UTSW 17 33650211 missense possibly damaging 0.54
R4926:Hnrnpm UTSW 17 33649801 missense probably damaging 0.97
R7456:Hnrnpm UTSW 17 33646648 missense possibly damaging 0.95
R8695:Hnrnpm UTSW 17 33658910 missense probably benign 0.00
R9079:Hnrnpm UTSW 17 33649801 missense probably damaging 0.97
R9626:Hnrnpm UTSW 17 33677290 missense probably damaging 1.00
Z1177:Hnrnpm UTSW 17 33646745 missense probably damaging 1.00
Z1177:Hnrnpm UTSW 17 33658401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGAATCCTGAAGCCACAAATGC -3'
(R):5'- ATCCTGATGGTGAACATGCAAGGAG -3'

Sequencing Primer
(F):5'- GCCACAAATGCAGTGGTC -3'
(R):5'- CATGCAAGGAGAGCAATGC -3'
Posted On 2014-03-14