Incidental Mutation 'R1454:Plcb3'
ID162236
Institutional Source Beutler Lab
Gene Symbol Plcb3
Ensembl Gene ENSMUSG00000024960
Gene Namephospholipase C, beta 3
Synonyms
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6953714-6969759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6955046 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1082 (R1082G)
Ref Sequence ENSEMBL: ENSMUSP00000025912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025910] [ENSMUST00000025912] [ENSMUST00000113423] [ENSMUST00000113426]
Predicted Effect probably benign
Transcript: ENSMUST00000025910
SMART Domains Protein: ENSMUSP00000025910
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 204 5e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000025912
AA Change: R1082G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025912
Gene: ENSMUSG00000024960
AA Change: R1082G

DomainStartEndE-ValueType
Pfam:EF-hand_like 225 316 6.6e-23 PFAM
PLCXc 317 468 4.26e-73 SMART
low complexity region 488 515 N/A INTRINSIC
low complexity region 553 578 N/A INTRINSIC
PLCYc 591 707 3.88e-76 SMART
C2 728 826 4.52e-14 SMART
low complexity region 917 936 N/A INTRINSIC
Pfam:PLC-beta_C 1029 1202 5.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113423
SMART Domains Protein: ENSMUSP00000109050
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 162 9.1e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113426
SMART Domains Protein: ENSMUSP00000109053
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 172 5.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141410
SMART Domains Protein: ENSMUSP00000114597
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 134 2.9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145463
SMART Domains Protein: ENSMUSP00000121778
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 51 1.4e-11 PFAM
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphoinositide phospholipase C beta enzyme family that catalyze the production of the secondary messengers diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol in G-protein-linked receptor-mediated signal transduction. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one targeted mutation die at E2.5 and exhibit poor embryonic organization and hypocellularity. Mice homozygous for a second targeted mutation survive to adulthood and exhibit an increased antinocieptive response to opioids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Plcb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Plcb3 APN 19 6955322 missense probably benign 0.27
IGL01370:Plcb3 APN 19 6962824 missense probably damaging 0.99
IGL01385:Plcb3 APN 19 6957908 missense probably benign
IGL01511:Plcb3 APN 19 6955843 missense probably damaging 0.99
IGL02182:Plcb3 APN 19 6969620 missense probably benign 0.22
IGL02240:Plcb3 APN 19 6958080 splice site probably benign
IGL02350:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02357:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02550:Plcb3 APN 19 6960176 nonsense probably null
IGL02866:Plcb3 APN 19 6957676 missense probably damaging 1.00
IGL03180:Plcb3 APN 19 6956153 missense probably benign 0.44
IGL03327:Plcb3 APN 19 6955052 missense probably benign
IGL03346:Plcb3 APN 19 6955052 missense probably benign
Multifarious UTSW 19 6954703 critical splice donor site probably null
R0042:Plcb3 UTSW 19 6966420 missense probably damaging 1.00
R0125:Plcb3 UTSW 19 6958908 missense probably damaging 1.00
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0724:Plcb3 UTSW 19 6963392 missense probably damaging 1.00
R0781:Plcb3 UTSW 19 6961913 nonsense probably null
R0945:Plcb3 UTSW 19 6954878 missense probably damaging 1.00
R1110:Plcb3 UTSW 19 6961913 nonsense probably null
R1414:Plcb3 UTSW 19 6963017 missense probably damaging 1.00
R1533:Plcb3 UTSW 19 6957673 missense possibly damaging 0.70
R1652:Plcb3 UTSW 19 6955296 missense probably benign 0.00
R1795:Plcb3 UTSW 19 6956013 unclassified probably benign
R1870:Plcb3 UTSW 19 6962985 missense probably benign 0.04
R1934:Plcb3 UTSW 19 6964609 missense probably damaging 1.00
R3980:Plcb3 UTSW 19 6966435 missense probably damaging 1.00
R4397:Plcb3 UTSW 19 6965825 missense probably damaging 0.96
R4533:Plcb3 UTSW 19 6956272 missense probably benign 0.08
R4576:Plcb3 UTSW 19 6959047 splice site probably benign
R4815:Plcb3 UTSW 19 6962984 missense possibly damaging 0.59
R4903:Plcb3 UTSW 19 6955843 missense probably damaging 0.99
R5093:Plcb3 UTSW 19 6966210 missense probably damaging 1.00
R5555:Plcb3 UTSW 19 6966219 missense probably benign 0.19
R5593:Plcb3 UTSW 19 6954749 missense possibly damaging 0.94
R5626:Plcb3 UTSW 19 6955275 missense probably benign 0.24
R5661:Plcb3 UTSW 19 6963220 missense probably damaging 1.00
R5713:Plcb3 UTSW 19 6957692 missense probably damaging 0.99
R5741:Plcb3 UTSW 19 6954422 nonsense probably null
R6025:Plcb3 UTSW 19 6956179 missense probably benign 0.03
R6063:Plcb3 UTSW 19 6962834 missense possibly damaging 0.69
R6155:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6157:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6178:Plcb3 UTSW 19 6954703 critical splice donor site probably null
R7085:Plcb3 UTSW 19 6960133 missense possibly damaging 0.80
R7117:Plcb3 UTSW 19 6964378 missense probably damaging 1.00
R7134:Plcb3 UTSW 19 6965330 missense probably damaging 1.00
R7153:Plcb3 UTSW 19 6958084 critical splice donor site probably null
R7316:Plcb3 UTSW 19 6966385 critical splice donor site probably null
R7366:Plcb3 UTSW 19 6962021 missense probably benign
R7399:Plcb3 UTSW 19 6962867 missense probably benign
R7736:Plcb3 UTSW 19 6969623 missense probably benign 0.00
R8057:Plcb3 UTSW 19 6955095 missense probably benign
R8057:Plcb3 UTSW 19 6958899 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTTACCGACTCAGTGATGTGCC -3'
(R):5'- GACAAGTACAGAGCCTGTTGGAGC -3'

Sequencing Primer
(F):5'- AGTGGCTCCCATCACACTTAC -3'
(R):5'- CGGAAGCTGGAGCATCTAC -3'
Posted On2014-03-14