Incidental Mutation 'R1426:Rbck1'
ID162239
Institutional Source Beutler Lab
Gene Symbol Rbck1
Ensembl Gene ENSMUSG00000027466
Gene NameRanBP-type and C3HC4-type zinc finger containing 1
SynonymsHOIL-1, HOIL-1L, Ubce7ip3
MMRRC Submission 039482-MU
Accession Numbers

Genbank: NM_001083921; MGI: 1344372

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152316334-152332653 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 152327241 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028964] [ENSMUST00000109847]
Predicted Effect probably benign
Transcript: ENSMUST00000028964
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109847
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131889
Predicted Effect probably benign
Transcript: ENSMUST00000144865
SMART Domains Protein: ENSMUSP00000118592
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
coiled coil region 13 41 N/A INTRINSIC
RING 63 107 2.67e-5 SMART
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145889
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased TNF-induced hepatocyte apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Rbck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Rbck1 APN 2 152318395 missense probably damaging 0.98
IGL00765:Rbck1 APN 2 152330954 splice site probably benign
IGL01647:Rbck1 APN 2 152323232 missense probably damaging 1.00
IGL01945:Rbck1 APN 2 152318316 missense probably damaging 1.00
IGL02141:Rbck1 APN 2 152318374 missense possibly damaging 0.56
IGL02573:Rbck1 APN 2 152322167 missense possibly damaging 0.90
IGL02950:Rbck1 APN 2 152331077 missense possibly damaging 0.95
green_fire UTSW 2 152323174 nonsense probably null
iron_throne UTSW 2 152318451 missense probably benign 0.45
Viserion UTSW 2 152330966 missense possibly damaging 0.87
westeros UTSW 2 152318733 nonsense probably null
A4554:Rbck1 UTSW 2 152319172 missense probably damaging 1.00
R0532:Rbck1 UTSW 2 152324330 missense probably damaging 0.99
R1598:Rbck1 UTSW 2 152323170 critical splice donor site probably null
R1666:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1668:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1889:Rbck1 UTSW 2 152318356 missense probably damaging 0.99
R4572:Rbck1 UTSW 2 152318733 nonsense probably null
R4592:Rbck1 UTSW 2 152318733 nonsense probably null
R5077:Rbck1 UTSW 2 152318451 missense probably benign 0.45
R6049:Rbck1 UTSW 2 152323174 nonsense probably null
R6494:Rbck1 UTSW 2 152330966 missense possibly damaging 0.87
R7530:Rbck1 UTSW 2 152324292 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GTGCCAGCCTCTGTCCAACC -3'
(R):5'- CAGACTTGAACAGTCCCCTGCC -3'

Sequencing Primer
(F):5'- actcacaatcgtccacaacc -3'
(R):5'- TGCACACCGTCACCATTT -3'
Posted On2014-03-14