Mutagenetix > Incidental Mutations

Incidental Mutation 'R1426:Adh1'

162240

Institutional Source

Beutler Lab

Gene Symbol

Adh1

Ensembl Gene

ENSMUSG00000074207

Gene Name

alcohol dehydrogenase 1 (class I)

Synonyms

class I alcohol dehydrogenase, ADH-AA, Adh1tl, Adh-1e, Adh-1t, Adh-1-t, Adh-1, Adh1-t, Adh1-e

MMRRC Submission

039482-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138260991-138290698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138286795 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 224 (D224G)

Ref Sequence

ENSEMBL: ENSMUSP00000004232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004232] [ENSMUST00000159159]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004232
AA Change: D224G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004232
Gene: ENSMUSG00000074207
AA Change: D224G

Domain	Start	End	E-Value	Type
Pfam:ADH_N	34	161	1.3e-25	PFAM
Pfam:ADH_zinc_N	203	337	3.6e-27	PFAM
Pfam:ADH_zinc_N_2	236	369	1.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162032

Meta Mutation Damage Score

0.2805

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired metabolism of (and sensitivity to) ethanol and retinol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,324,435	V214E	probably damaging	Het
Arhgap28	C	A	17: 67,857,464	Q554H	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Brat1	G	A	5: 140,718,013	V674I	probably benign	Het
Brd2	ATCTTCTTC	ATCTTC	17: 34,114,007		probably benign	Het
Ccdc162	T	C	10: 41,553,182	D438G	possibly damaging	Het
Cyp4x1	T	A	4: 115,112,791		probably benign	Het
Dip2a	T	C	10: 76,279,820		probably benign	Het
Eif2s1	A	G	12: 78,881,168	D206G	probably benign	Het
Elovl7	T	A	13: 108,282,494	I220N	possibly damaging	Het
Gsto1	A	G	19: 47,857,942	E76G	probably damaging	Het
Hspa14	A	T	2: 3,508,821	W12R	probably damaging	Het
L3mbtl2	T	A	15: 81,676,317	C260S	possibly damaging	Het
Lama3	G	T	18: 12,481,098		probably null	Het
Lrrc34	T	A	3: 30,643,579		probably benign	Het
Lrrc45	A	T	11: 120,720,013	Q525L	probably benign	Het
Lss	T	C	10: 76,536,303	I164T	probably damaging	Het
Myh11	T	A	16: 14,205,931	K1527*	probably null	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Ncoa1	T	A	12: 4,270,737		probably benign	Het
Olfr262	G	T	19: 12,241,182	Q160K	possibly damaging	Het
Olfr768	A	T	10: 129,093,690	C95S	probably damaging	Het
Pafah1b3	T	C	7: 25,297,135	E41G	possibly damaging	Het
Pnmal1	C	T	7: 16,960,984	P255S	possibly damaging	Het
Prkar2b	A	T	12: 31,962,988		probably benign	Het
Rbck1	A	T	2: 152,327,241		probably benign	Het
Rcor2	A	G	19: 7,271,030	S137G	possibly damaging	Het
Slc25a48	T	A	13: 56,448,991		probably benign	Het
Slc7a4	A	G	16: 17,573,944		probably null	Het
Tert	T	C	13: 73,642,353		probably benign	Het
Traf7	A	T	17: 24,511,681	I344N	probably damaging	Het
Vmn1r194	T	A	13: 22,245,066	F284L	probably damaging	Het
Xpc	A	G	6: 91,493,238	M699T	probably damaging	Het
Zbtb5	T	C	4: 44,993,968	H472R	possibly damaging	Het
Zfp786	A	G	6: 47,825,079	V88A	probably benign	Het
Zkscan7	T	C	9: 122,895,163	I399T	probably benign	Het
Zyg11b	G	A	4: 108,250,812	R466C	probably damaging	Het

Other mutations in Adh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Adh1	APN	3	138282499	missense	probably benign	0.00
IGL00510:Adh1	APN	3	138289907	missense	probably damaging	1.00
IGL01326:Adh1	APN	3	138286911	missense	probably damaging	1.00
IGL01662:Adh1	APN	3	138282751	missense	possibly damaging	0.96
IGL02090:Adh1	APN	3	138282785	missense	possibly damaging	0.95
PIT4687001:Adh1	UTSW	3	138289835	missense	probably damaging	1.00
R0413:Adh1	UTSW	3	138280432	missense	probably benign	0.00
R0882:Adh1	UTSW	3	138286797	missense	possibly damaging	0.65
R1464:Adh1	UTSW	3	138288747	critical splice acceptor site	probably null
R1464:Adh1	UTSW	3	138288747	critical splice acceptor site	probably null
R1901:Adh1	UTSW	3	138288797	missense	probably benign	0.00
R2056:Adh1	UTSW	3	138286915	missense	probably damaging	1.00
R2095:Adh1	UTSW	3	138282796	missense	probably damaging	1.00
R3155:Adh1	UTSW	3	138280489	missense	probably damaging	0.99
R3752:Adh1	UTSW	3	138288794	missense	probably benign
R3795:Adh1	UTSW	3	138279765	missense	possibly damaging	0.85
R4351:Adh1	UTSW	3	138280497	missense	probably benign	0.21
R4698:Adh1	UTSW	3	138282513	missense	probably benign	0.05
R4747:Adh1	UTSW	3	138288881	missense	probably damaging	1.00
R5626:Adh1	UTSW	3	138280410	missense	probably benign	0.04
R6014:Adh1	UTSW	3	138286798	missense	probably benign	0.00
R6060:Adh1	UTSW	3	138286783	missense	probably damaging	1.00
R6225:Adh1	UTSW	3	138289804	missense	probably benign	0.04
R6637:Adh1	UTSW	3	138282470	nonsense	probably null
R7129:Adh1	UTSW	3	138280474	missense	probably damaging	0.98
R7288:Adh1	UTSW	3	138282732	missense	probably benign
R7291:Adh1	UTSW	3	138282808	missense	probably damaging	1.00
R7367:Adh1	UTSW	3	138290551	missense	probably benign	0.04
R7378:Adh1	UTSW	3	138288887	splice site	probably null
R7453:Adh1	UTSW	3	138289941	critical splice donor site	probably null
R7613:Adh1	UTSW	3	138286831	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACAGCAAGGCAATATGTGCAGTG -3'
(R):5'- ACAGCGAATTAAGCAGTCTGAGCAG -3'

Sequencing Primer
(F):5'- CAATATGTGCAGTGGGGAGC -3'
(R):5'- GTCTACCTAGAGCATTCTAGATGG -3'

Posted On

2014-03-14