Incidental Mutation 'R1426:Adh1'
ID162240
Institutional Source Beutler Lab
Gene Symbol Adh1
Ensembl Gene ENSMUSG00000074207
Gene Namealcohol dehydrogenase 1 (class I)
Synonymsclass I alcohol dehydrogenase, ADH-AA, Adh1tl, Adh-1e, Adh-1t, Adh-1-t, Adh-1, Adh1-t, Adh1-e
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138260991-138290698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138286795 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 224 (D224G)
Ref Sequence ENSEMBL: ENSMUSP00000004232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004232] [ENSMUST00000159159]
Predicted Effect probably damaging
Transcript: ENSMUST00000004232
AA Change: D224G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004232
Gene: ENSMUSG00000074207
AA Change: D224G

DomainStartEndE-ValueType
Pfam:ADH_N 34 161 1.3e-25 PFAM
Pfam:ADH_zinc_N 203 337 3.6e-27 PFAM
Pfam:ADH_zinc_N_2 236 369 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162032
Meta Mutation Damage Score 0.2805 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired metabolism of (and sensitivity to) ethanol and retinol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Adh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Adh1 APN 3 138282499 missense probably benign 0.00
IGL00510:Adh1 APN 3 138289907 missense probably damaging 1.00
IGL01326:Adh1 APN 3 138286911 missense probably damaging 1.00
IGL01662:Adh1 APN 3 138282751 missense possibly damaging 0.96
IGL02090:Adh1 APN 3 138282785 missense possibly damaging 0.95
PIT4687001:Adh1 UTSW 3 138289835 missense probably damaging 1.00
R0413:Adh1 UTSW 3 138280432 missense probably benign 0.00
R0882:Adh1 UTSW 3 138286797 missense possibly damaging 0.65
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1901:Adh1 UTSW 3 138288797 missense probably benign 0.00
R2056:Adh1 UTSW 3 138286915 missense probably damaging 1.00
R2095:Adh1 UTSW 3 138282796 missense probably damaging 1.00
R3155:Adh1 UTSW 3 138280489 missense probably damaging 0.99
R3752:Adh1 UTSW 3 138288794 missense probably benign
R3795:Adh1 UTSW 3 138279765 missense possibly damaging 0.85
R4351:Adh1 UTSW 3 138280497 missense probably benign 0.21
R4698:Adh1 UTSW 3 138282513 missense probably benign 0.05
R4747:Adh1 UTSW 3 138288881 missense probably damaging 1.00
R5626:Adh1 UTSW 3 138280410 missense probably benign 0.04
R6014:Adh1 UTSW 3 138286798 missense probably benign 0.00
R6060:Adh1 UTSW 3 138286783 missense probably damaging 1.00
R6225:Adh1 UTSW 3 138289804 missense probably benign 0.04
R6637:Adh1 UTSW 3 138282470 nonsense probably null
R7129:Adh1 UTSW 3 138280474 missense probably damaging 0.98
R7288:Adh1 UTSW 3 138282732 missense probably benign
R7291:Adh1 UTSW 3 138282808 missense probably damaging 1.00
R7367:Adh1 UTSW 3 138290551 missense probably benign 0.04
R7378:Adh1 UTSW 3 138288887 splice site probably null
R7453:Adh1 UTSW 3 138289941 critical splice donor site probably null
R7613:Adh1 UTSW 3 138286831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGCAAGGCAATATGTGCAGTG -3'
(R):5'- ACAGCGAATTAAGCAGTCTGAGCAG -3'

Sequencing Primer
(F):5'- CAATATGTGCAGTGGGGAGC -3'
(R):5'- GTCTACCTAGAGCATTCTAGATGG -3'
Posted On2014-03-14