Mutagenetix > Incidental Mutation

Incidental Mutation 'R1426:Xpc'

162246

Institutional Source

Beutler Lab

Gene Symbol

Xpc

Ensembl Gene

ENSMUSG00000030094

Gene Name

xeroderma pigmentosum, complementation group C

Synonyms

MMRRC Submission

039482-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.367) question?

Stock #

R1426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91489305-91515888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91493238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 699 (M699T)

Ref Sequence

ENSEMBL: ENSMUSP00000032182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000032183]

AlphaFold

P51612

Predicted Effect

probably damaging
Transcript: ENSMUST00000032182
AA Change: M699T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094
AA Change: M699T

Domain	Start	End	E-Value	Type
low complexity region	69	82	N/A	INTRINSIC
low complexity region	106	115	N/A	INTRINSIC
low complexity region	118	142	N/A	INTRINSIC
low complexity region	299	315	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	371	387	N/A	INTRINSIC
low complexity region	425	439	N/A	INTRINSIC
Pfam:Rad4	485	619	6.4e-26	PFAM
BHD_1	623	675	4.09e-25	SMART
BHD_2	677	737	4.96e-24	SMART
BHD_3	744	818	4.83e-45	SMART
low complexity region	826	835	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000032183

SMART Domains

Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095

Domain	Start	End	E-Value	Type
transmembrane domain	32	51	N/A	INTRINSIC
Pfam:DUF1625	121	373	3.6e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150279

Meta Mutation Damage Score

0.5446

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,324,435	V214E	probably damaging	Het
Adh1	A	G	3: 138,286,795	D224G	probably damaging	Het
Arhgap28	C	A	17: 67,857,464	Q554H	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Brat1	G	A	5: 140,718,013	V674I	probably benign	Het
Brd2	ATCTTCTTC	ATCTTC	17: 34,114,007		probably benign	Het
Ccdc162	T	C	10: 41,553,182	D438G	possibly damaging	Het
Cyp4x1	T	A	4: 115,112,791		probably benign	Het
Dip2a	T	C	10: 76,279,820		probably benign	Het
Eif2s1	A	G	12: 78,881,168	D206G	probably benign	Het
Elovl7	T	A	13: 108,282,494	I220N	possibly damaging	Het
Gsto1	A	G	19: 47,857,942	E76G	probably damaging	Het
Hspa14	A	T	2: 3,508,821	W12R	probably damaging	Het
L3mbtl2	T	A	15: 81,676,317	C260S	possibly damaging	Het
Lama3	G	T	18: 12,481,098		probably null	Het
Lrrc34	T	A	3: 30,643,579		probably benign	Het
Lrrc45	A	T	11: 120,720,013	Q525L	probably benign	Het
Lss	T	C	10: 76,536,303	I164T	probably damaging	Het
Myh11	T	A	16: 14,205,931	K1527*	probably null	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Ncoa1	T	A	12: 4,270,737		probably benign	Het
Olfr262	G	T	19: 12,241,182	Q160K	possibly damaging	Het
Olfr768	A	T	10: 129,093,690	C95S	probably damaging	Het
Pafah1b3	T	C	7: 25,297,135	E41G	possibly damaging	Het
Pnmal1	C	T	7: 16,960,984	P255S	possibly damaging	Het
Prkar2b	A	T	12: 31,962,988		probably benign	Het
Rbck1	A	T	2: 152,327,241		probably benign	Het
Rcor2	A	G	19: 7,271,030	S137G	possibly damaging	Het
Slc25a48	T	A	13: 56,448,991		probably benign	Het
Slc7a4	A	G	16: 17,573,944		probably null	Het
Tert	T	C	13: 73,642,353		probably benign	Het
Traf7	A	T	17: 24,511,681	I344N	probably damaging	Het
Vmn1r194	T	A	13: 22,245,066	F284L	probably damaging	Het
Zbtb5	T	C	4: 44,993,968	H472R	possibly damaging	Het
Zfp786	A	G	6: 47,825,079	V88A	probably benign	Het
Zkscan7	T	C	9: 122,895,163	I399T	probably benign	Het
Zyg11b	G	A	4: 108,250,812	R466C	probably damaging	Het

Other mutations in Xpc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Xpc	APN	6	91492264	unclassified	probably benign
IGL01108:Xpc	APN	6	91493005	missense	probably damaging	1.00
IGL01310:Xpc	APN	6	91490107	missense	probably benign	0.02
IGL01323:Xpc	APN	6	91492353	missense	probably damaging	1.00
IGL01350:Xpc	APN	6	91500011	missense	probably benign	0.01
IGL01656:Xpc	APN	6	91505467	missense	probably damaging	0.98
IGL01922:Xpc	APN	6	91505425	missense	probably damaging	1.00
IGL02412:Xpc	APN	6	91499785	missense	probably benign	0.01
IGL02448:Xpc	APN	6	91515744	missense	probably benign	0.00
IGL02571:Xpc	APN	6	91504071	missense	probably benign	0.00
IGL02937:Xpc	APN	6	91500137	missense	probably damaging	1.00
IGL02951:Xpc	APN	6	91506849	missense	probably damaging	1.00
IGL03033:Xpc	APN	6	91491315	splice site	probably null
IGL03248:Xpc	APN	6	91504583	missense	probably damaging	0.99
IGL03046:Xpc	UTSW	6	91510481	missense	probably damaging	1.00
R0031:Xpc	UTSW	6	91491226	missense	probably benign	0.01
R0173:Xpc	UTSW	6	91504735	unclassified	probably benign
R0285:Xpc	UTSW	6	91498064	missense	probably damaging	0.99
R0454:Xpc	UTSW	6	91491226	missense	probably benign	0.01
R0535:Xpc	UTSW	6	91504578	missense	possibly damaging	0.92
R0554:Xpc	UTSW	6	91491226	missense	probably benign	0.01
R0759:Xpc	UTSW	6	91498142	missense	probably damaging	0.99
R1478:Xpc	UTSW	6	91508528	missense	possibly damaging	0.94
R1676:Xpc	UTSW	6	91492947	missense	possibly damaging	0.56
R1969:Xpc	UTSW	6	91501025	splice site	probably null
R2138:Xpc	UTSW	6	91498122	nonsense	probably null
R2237:Xpc	UTSW	6	91498108	missense	probably damaging	1.00
R4580:Xpc	UTSW	6	91500011	missense	probably benign	0.01
R5318:Xpc	UTSW	6	91493010	missense	probably damaging	1.00
R5567:Xpc	UTSW	6	91498135	missense	probably damaging	1.00
R5681:Xpc	UTSW	6	91504120	missense	probably damaging	1.00
R6022:Xpc	UTSW	6	91499636	missense	probably damaging	0.96
R6791:Xpc	UTSW	6	91506857	missense	probably benign	0.01
R6794:Xpc	UTSW	6	91506857	missense	probably benign	0.01
R6983:Xpc	UTSW	6	91504023	missense	probably damaging	0.99
R7214:Xpc	UTSW	6	91492338	missense	probably damaging	1.00
R7442:Xpc	UTSW	6	91504649	missense	probably damaging	1.00
R7524:Xpc	UTSW	6	91499531	missense	probably benign	0.23
R7581:Xpc	UTSW	6	91498017	splice site	probably benign
R8002:Xpc	UTSW	6	91492305	missense	probably damaging	0.98
R8992:Xpc	UTSW	6	91500974	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GGTACACGTTCCCAAACTCATTCCG -3'
(R):5'- GAGCAAAGGTCTGCTTCACCTCTC -3'

Sequencing Primer
(F):5'- AGcccactctgaccccc -3'
(R):5'- gtctgcttcaCCTCTCTCACAG -3'

Posted On

2014-03-14