Incidental Mutation 'R1426:Pnmal1'
ID162247
Institutional Source Beutler Lab
Gene Symbol Pnmal1
Ensembl Gene ENSMUSG00000041141
Gene NamePNMA-like 1
Synonyms
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16959679-16964607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16960984 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 255 (P255S)
Ref Sequence ENSEMBL: ENSMUSP00000040929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038163
AA Change: P255S

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141
AA Change: P255S

DomainStartEndE-ValueType
Pfam:PNMA 5 364 6.9e-108 PFAM
Meta Mutation Damage Score 0.0512 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Pnmal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Pnmal1 UTSW 7 16961425 small insertion probably benign
R0116:Pnmal1 UTSW 7 16960700 missense probably damaging 0.97
R0140:Pnmal1 UTSW 7 16960222 start codon destroyed probably null 0.00
R1109:Pnmal1 UTSW 7 16961467 nonsense probably null
R1306:Pnmal1 UTSW 7 16962025 missense probably benign 0.00
R2000:Pnmal1 UTSW 7 16961039 missense probably benign 0.01
R2404:Pnmal1 UTSW 7 16960391 missense probably damaging 1.00
R3415:Pnmal1 UTSW 7 16960954 missense possibly damaging 0.74
R3708:Pnmal1 UTSW 7 16960225 missense probably damaging 1.00
R4009:Pnmal1 UTSW 7 16961376 missense probably damaging 1.00
R4105:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
R5126:Pnmal1 UTSW 7 16961317 missense probably benign 0.03
R5244:Pnmal1 UTSW 7 16961323 missense probably damaging 0.99
R5825:Pnmal1 UTSW 7 16961095 missense probably benign 0.01
R5931:Pnmal1 UTSW 7 16960884 missense probably benign 0.31
R6128:Pnmal1 UTSW 7 16960736 missense probably benign 0.00
R7337:Pnmal1 UTSW 7 16961390 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCCTCTTGAAGCTTAACCCTAACCC -3'
(R):5'- CGGTCCACCATCTTGATCTGAATCC -3'

Sequencing Primer
(F):5'- ATGCTGCAATCCGTAGTCG -3'
(R):5'- GATCTGAATCCTCTAGGTTCCCG -3'
Posted On2014-03-14