Incidental Mutation 'R1426:Zkscan7'
ID162249
Institutional Source Beutler Lab
Gene Symbol Zkscan7
Ensembl Gene ENSMUSG00000063488
Gene Namezinc finger with KRAB and SCAN domains 7
SynonymsZfp167
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122885685-122898618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122895163 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 399 (I399T)
Ref Sequence ENSEMBL: ENSMUSP00000071695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063980] [ENSMUST00000215872]
Predicted Effect probably benign
Transcript: ENSMUST00000063980
AA Change: I399T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071695
Gene: ENSMUSG00000063488
AA Change: I399T

DomainStartEndE-ValueType
SCAN 45 156 1.18e-65 SMART
ZnF_C2H2 350 372 5.59e-4 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 434 456 8.4e1 SMART
ZnF_C2H2 487 509 4.24e-4 SMART
ZnF_C2H2 515 537 8.34e-3 SMART
ZnF_C2H2 543 565 7.37e-4 SMART
ZnF_C2H2 571 593 1.92e-2 SMART
ZnF_C2H2 599 621 1.13e-4 SMART
ZnF_C2H2 627 649 2.24e-3 SMART
ZnF_C2H2 655 677 4.17e-3 SMART
ZnF_C2H2 683 705 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214426
Predicted Effect probably benign
Transcript: ENSMUST00000215872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216924
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Zkscan7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Zkscan7 APN 9 122895594 missense possibly damaging 0.95
IGL01650:Zkscan7 APN 9 122894827 missense probably benign
IGL01905:Zkscan7 APN 9 122890761 missense possibly damaging 0.93
IGL02466:Zkscan7 APN 9 122888885 missense probably damaging 0.98
R0310:Zkscan7 UTSW 9 122888893 nonsense probably null
R0355:Zkscan7 UTSW 9 122888807 missense probably damaging 1.00
R0477:Zkscan7 UTSW 9 122890809 splice site probably null
R1276:Zkscan7 UTSW 9 122890723 missense probably damaging 0.98
R2055:Zkscan7 UTSW 9 122888937 missense probably damaging 1.00
R2195:Zkscan7 UTSW 9 122895621 missense possibly damaging 0.73
R2354:Zkscan7 UTSW 9 122894827 missense probably benign
R4878:Zkscan7 UTSW 9 122890800 nonsense probably null
R5106:Zkscan7 UTSW 9 122896133 unclassified probably benign
R6266:Zkscan7 UTSW 9 122895234 nonsense probably null
R6299:Zkscan7 UTSW 9 122888717 missense probably damaging 1.00
R6513:Zkscan7 UTSW 9 122896105 missense probably benign 0.00
R6881:Zkscan7 UTSW 9 122888701 missense possibly damaging 0.96
R7640:Zkscan7 UTSW 9 122896056 missense possibly damaging 0.71
R7920:Zkscan7 UTSW 9 122895909 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAATGCCCTCCAGTCCTGTTGAGC -3'
(R):5'- GCCTCGCCAGATTCATCAGGTTTC -3'

Sequencing Primer
(F):5'- CCAGTCCTGTTGAGCATCAG -3'
(R):5'- AGATTCATCAGGTTTCTCTCCAGTG -3'
Posted On2014-03-14