Incidental Mutation 'R1426:Olfr768'
ID162252
Institutional Source Beutler Lab
Gene Symbol Olfr768
Ensembl Gene ENSMUSG00000050198
Gene Nameolfactory receptor 768
SynonymsGA_x6K02T2PULF-10779441-10778503, MOR114-4
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129090222-129099375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129093690 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 95 (C95S)
Ref Sequence ENSEMBL: ENSMUSP00000089619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063031]
Predicted Effect probably damaging
Transcript: ENSMUST00000063031
AA Change: C95S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089619
Gene: ENSMUSG00000050198
AA Change: C95S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216681
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Olfr768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Olfr768 APN 10 129093396 missense probably benign 0.08
IGL01947:Olfr768 APN 10 129093878 missense possibly damaging 0.52
IGL03026:Olfr768 APN 10 129093188 missense possibly damaging 0.60
R1353:Olfr768 UTSW 10 129093864 missense probably benign 0.14
R1766:Olfr768 UTSW 10 129093747 missense probably benign 0.24
R2356:Olfr768 UTSW 10 129093892 missense probably benign 0.40
R3522:Olfr768 UTSW 10 129093842 missense possibly damaging 0.93
R3751:Olfr768 UTSW 10 129093306 missense probably damaging 1.00
R3779:Olfr768 UTSW 10 129093296 missense possibly damaging 0.94
R4582:Olfr768 UTSW 10 129093158 missense possibly damaging 0.93
R4772:Olfr768 UTSW 10 129093668 missense possibly damaging 0.92
R4792:Olfr768 UTSW 10 129093620 missense probably damaging 1.00
R5749:Olfr768 UTSW 10 129093097 missense probably damaging 0.98
R6571:Olfr768 UTSW 10 129093121 missense probably damaging 0.98
R6619:Olfr768 UTSW 10 129093454 missense possibly damaging 0.95
R7052:Olfr768 UTSW 10 129093875 missense probably damaging 0.98
R7096:Olfr768 UTSW 10 129093846 missense probably damaging 0.97
R7409:Olfr768 UTSW 10 129093212 missense probably damaging 1.00
R7852:Olfr768 UTSW 10 129093516 missense probably benign 0.45
R8332:Olfr768 UTSW 10 129093305 missense possibly damaging 0.95
X0024:Olfr768 UTSW 10 129093115 missense possibly damaging 0.95
X0024:Olfr768 UTSW 10 129093347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAATAAGGAACTGGATGCAGACC -3'
(R):5'- GGCCACAGTCAGGAATCAGTGATG -3'

Sequencing Primer
(F):5'- AACTGGATGCAGACCCTGTTG -3'
(R):5'- TCCTGGTAGGACTAACCAATGATG -3'
Posted On2014-03-14