Mutagenetix > Incidental Mutations

Incidental Mutation 'R1426:Eif2s1'

162256

Institutional Source

Beutler Lab

Gene Symbol

Eif2s1

Ensembl Gene

ENSMUSG00000021116

Gene Name

eukaryotic translation initiation factor 2, subunit 1 alpha

Synonyms

eIF2alpha, 0910001O23Rik, 2410026C18Rik, Eif2a

MMRRC Submission

039482-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78861819-78887010 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78881168 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 206 (D206G)

Ref Sequence

ENSEMBL: ENSMUSP00000071214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071230]

Predicted Effect

probably benign
Transcript: ENSMUST00000071230
AA Change: D206G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000071214
Gene: ENSMUSG00000021116
AA Change: D206G

Domain	Start	End	E-Value	Type
S1	15	88	1.72e-12	SMART
Pfam:EIF_2_alpha	130	244	1e-40	PFAM
coiled coil region	284	310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220382

Meta Mutation Damage Score

0.4728

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The translation initiation factor EIF2 catalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits. Binding occurs as a ternary complex of methionyl-tRNA, EIF2, and GTP. EIF2 is composed of 3 nonidentical subunits, the 36-kD EIF2-alpha subunit (EIF2S1), the 38-kD EIF2-beta subunit (EIF2S2; MIM 603908), and the 52-kD EIF2-gamma subunit (EIF2S3; MIM 300161). The rate of formation of the ternary complex is modulated by the phosphorylation state of EIF2-alpha (Ernst et al., 1987 [PubMed 2948954]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knocked-in point mutation die within hours of birth and exhibit hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,324,435	V214E	probably damaging	Het
Adh1	A	G	3: 138,286,795	D224G	probably damaging	Het
Arhgap28	C	A	17: 67,857,464	Q554H	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Brat1	G	A	5: 140,718,013	V674I	probably benign	Het
Brd2	ATCTTCTTC	ATCTTC	17: 34,114,007		probably benign	Het
Ccdc162	T	C	10: 41,553,182	D438G	possibly damaging	Het
Cyp4x1	T	A	4: 115,112,791		probably benign	Het
Dip2a	T	C	10: 76,279,820		probably benign	Het
Elovl7	T	A	13: 108,282,494	I220N	possibly damaging	Het
Gsto1	A	G	19: 47,857,942	E76G	probably damaging	Het
Hspa14	A	T	2: 3,508,821	W12R	probably damaging	Het
L3mbtl2	T	A	15: 81,676,317	C260S	possibly damaging	Het
Lama3	G	T	18: 12,481,098		probably null	Het
Lrrc34	T	A	3: 30,643,579		probably benign	Het
Lrrc45	A	T	11: 120,720,013	Q525L	probably benign	Het
Lss	T	C	10: 76,536,303	I164T	probably damaging	Het
Myh11	T	A	16: 14,205,931	K1527*	probably null	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Ncoa1	T	A	12: 4,270,737		probably benign	Het
Olfr262	G	T	19: 12,241,182	Q160K	possibly damaging	Het
Olfr768	A	T	10: 129,093,690	C95S	probably damaging	Het
Pafah1b3	T	C	7: 25,297,135	E41G	possibly damaging	Het
Pnmal1	C	T	7: 16,960,984	P255S	possibly damaging	Het
Prkar2b	A	T	12: 31,962,988		probably benign	Het
Rbck1	A	T	2: 152,327,241		probably benign	Het
Rcor2	A	G	19: 7,271,030	S137G	possibly damaging	Het
Slc25a48	T	A	13: 56,448,991		probably benign	Het
Slc7a4	A	G	16: 17,573,944		probably null	Het
Tert	T	C	13: 73,642,353		probably benign	Het
Traf7	A	T	17: 24,511,681	I344N	probably damaging	Het
Vmn1r194	T	A	13: 22,245,066	F284L	probably damaging	Het
Xpc	A	G	6: 91,493,238	M699T	probably damaging	Het
Zbtb5	T	C	4: 44,993,968	H472R	possibly damaging	Het
Zfp786	A	G	6: 47,825,079	V88A	probably benign	Het
Zkscan7	T	C	9: 122,895,163	I399T	probably benign	Het
Zyg11b	G	A	4: 108,250,812	R466C	probably damaging	Het

Other mutations in Eif2s1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00577:Eif2s1	APN	12	78866646	missense	possibly damaging	0.92
IGL00736:Eif2s1	APN	12	78884837	unclassified	probably benign
IGL02072:Eif2s1	APN	12	78880014	missense	probably benign	0.04
IGL02312:Eif2s1	APN	12	78880016	missense	probably damaging	1.00
IGL03379:Eif2s1	APN	12	78866580	missense	probably benign	0.00
Sistine	UTSW	12	78883352	missense	possibly damaging	0.71
R0669:Eif2s1	UTSW	12	78881238	splice site	probably benign
R1644:Eif2s1	UTSW	12	78866521	splice site	probably null
R1998:Eif2s1	UTSW	12	78866734	missense	possibly damaging	0.90
R2069:Eif2s1	UTSW	12	78877185	missense	probably benign	0.03
R3885:Eif2s1	UTSW	12	78881225	missense	probably damaging	1.00
R4704:Eif2s1	UTSW	12	78877170	missense	probably benign	0.31
R4964:Eif2s1	UTSW	12	78880011	missense	probably benign
R5908:Eif2s1	UTSW	12	78880043	missense	probably damaging	0.99
R6473:Eif2s1	UTSW	12	78881225	missense	probably damaging	1.00
R6601:Eif2s1	UTSW	12	78883352	missense	possibly damaging	0.71
R7043:Eif2s1	UTSW	12	78877108	missense	probably damaging	0.99
R7358:Eif2s1	UTSW	12	78881195	missense	probably damaging	1.00
R8516:Eif2s1	UTSW	12	78881162	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATATTCTTAGCATTTGGGAAGCCCT -3'
(R):5'- AGCTGTACTTTTCTACCCAACATGACC -3'

Sequencing Primer
(F):5'- gctcagcaagtaaagccactc -3'
(R):5'- ACATGACCAGCCAAAAGGG -3'

Posted On

2014-03-14