Incidental Mutation 'R1426:Eif2s1'
ID 162256
Institutional Source Beutler Lab
Gene Symbol Eif2s1
Ensembl Gene ENSMUSG00000021116
Gene Name eukaryotic translation initiation factor 2, subunit 1 alpha
Synonyms 0910001O23Rik, Eif2a, eIF2alpha, 2410026C18Rik
MMRRC Submission 039482-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1426 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 78908846-78933784 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78927942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 206 (D206G)
Ref Sequence ENSEMBL: ENSMUSP00000071214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071230]
AlphaFold Q6ZWX6
Predicted Effect probably benign
Transcript: ENSMUST00000071230
AA Change: D206G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000071214
Gene: ENSMUSG00000021116
AA Change: D206G

DomainStartEndE-ValueType
S1 15 88 1.72e-12 SMART
Pfam:EIF_2_alpha 130 244 1e-40 PFAM
coiled coil region 284 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220382
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The translation initiation factor EIF2 catalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits. Binding occurs as a ternary complex of methionyl-tRNA, EIF2, and GTP. EIF2 is composed of 3 nonidentical subunits, the 36-kD EIF2-alpha subunit (EIF2S1), the 38-kD EIF2-beta subunit (EIF2S2; MIM 603908), and the 52-kD EIF2-gamma subunit (EIF2S3; MIM 300161). The rate of formation of the ternary complex is modulated by the phosphorylation state of EIF2-alpha (Ernst et al., 1987 [PubMed 2948954]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knocked-in point mutation die within hours of birth and exhibit hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,635,361 (GRCm39) V214E probably damaging Het
Adh1 A G 3: 137,992,556 (GRCm39) D224G probably damaging Het
Arhgap28 C A 17: 68,164,459 (GRCm39) Q554H probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Brat1 G A 5: 140,703,768 (GRCm39) V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,332,981 (GRCm39) probably benign Het
Ccdc162 T C 10: 41,429,178 (GRCm39) D438G possibly damaging Het
Cyp4x1 T A 4: 114,969,988 (GRCm39) probably benign Het
Dip2a T C 10: 76,115,654 (GRCm39) probably benign Het
Elovl7 T A 13: 108,419,028 (GRCm39) I220N possibly damaging Het
Gsto1 A G 19: 47,846,381 (GRCm39) E76G probably damaging Het
Hspa14 A T 2: 3,509,858 (GRCm39) W12R probably damaging Het
L3mbtl2 T A 15: 81,560,518 (GRCm39) C260S possibly damaging Het
Lama3 G T 18: 12,614,155 (GRCm39) probably null Het
Lrrc34 T A 3: 30,697,728 (GRCm39) probably benign Het
Lrrc45 A T 11: 120,610,839 (GRCm39) Q525L probably benign Het
Lss T C 10: 76,372,137 (GRCm39) I164T probably damaging Het
Myh11 T A 16: 14,023,795 (GRCm39) K1527* probably null Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Ncoa1 T A 12: 4,320,737 (GRCm39) probably benign Het
Or5an1c G T 19: 12,218,546 (GRCm39) Q160K possibly damaging Het
Or6c38 A T 10: 128,929,559 (GRCm39) C95S probably damaging Het
Pafah1b3 T C 7: 24,996,560 (GRCm39) E41G possibly damaging Het
Pnma8a C T 7: 16,694,909 (GRCm39) P255S possibly damaging Het
Prkar2b A T 12: 32,012,987 (GRCm39) probably benign Het
Rbck1 A T 2: 152,169,161 (GRCm39) probably benign Het
Rcor2 A G 19: 7,248,395 (GRCm39) S137G possibly damaging Het
Slc25a48 T A 13: 56,596,804 (GRCm39) probably benign Het
Slc7a4 A G 16: 17,391,808 (GRCm39) probably null Het
Tert T C 13: 73,790,472 (GRCm39) probably benign Het
Traf7 A T 17: 24,730,655 (GRCm39) I344N probably damaging Het
Vmn1r194 T A 13: 22,429,236 (GRCm39) F284L probably damaging Het
Xpc A G 6: 91,470,220 (GRCm39) M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 (GRCm39) H472R possibly damaging Het
Zfp786 A G 6: 47,802,013 (GRCm39) V88A probably benign Het
Zkscan7 T C 9: 122,724,228 (GRCm39) I399T probably benign Het
Zyg11b G A 4: 108,108,009 (GRCm39) R466C probably damaging Het
Other mutations in Eif2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Eif2s1 APN 12 78,913,420 (GRCm39) missense possibly damaging 0.92
IGL00736:Eif2s1 APN 12 78,931,611 (GRCm39) unclassified probably benign
IGL02072:Eif2s1 APN 12 78,926,788 (GRCm39) missense probably benign 0.04
IGL02312:Eif2s1 APN 12 78,926,790 (GRCm39) missense probably damaging 1.00
IGL03379:Eif2s1 APN 12 78,913,354 (GRCm39) missense probably benign 0.00
Sistine UTSW 12 78,930,126 (GRCm39) missense possibly damaging 0.71
R0669:Eif2s1 UTSW 12 78,928,012 (GRCm39) splice site probably benign
R1644:Eif2s1 UTSW 12 78,913,295 (GRCm39) splice site probably null
R1998:Eif2s1 UTSW 12 78,913,508 (GRCm39) missense possibly damaging 0.90
R2069:Eif2s1 UTSW 12 78,923,959 (GRCm39) missense probably benign 0.03
R3885:Eif2s1 UTSW 12 78,927,999 (GRCm39) missense probably damaging 1.00
R4704:Eif2s1 UTSW 12 78,923,944 (GRCm39) missense probably benign 0.31
R4964:Eif2s1 UTSW 12 78,926,785 (GRCm39) missense probably benign
R5908:Eif2s1 UTSW 12 78,926,817 (GRCm39) missense probably damaging 0.99
R6473:Eif2s1 UTSW 12 78,927,999 (GRCm39) missense probably damaging 1.00
R6601:Eif2s1 UTSW 12 78,930,126 (GRCm39) missense possibly damaging 0.71
R7043:Eif2s1 UTSW 12 78,923,882 (GRCm39) missense probably damaging 0.99
R7358:Eif2s1 UTSW 12 78,927,969 (GRCm39) missense probably damaging 1.00
R8516:Eif2s1 UTSW 12 78,927,936 (GRCm39) missense probably damaging 1.00
R8875:Eif2s1 UTSW 12 78,913,461 (GRCm39) missense probably damaging 1.00
R9236:Eif2s1 UTSW 12 78,921,343 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCATATTCTTAGCATTTGGGAAGCCCT -3'
(R):5'- AGCTGTACTTTTCTACCCAACATGACC -3'

Sequencing Primer
(F):5'- gctcagcaagtaaagccactc -3'
(R):5'- ACATGACCAGCCAAAAGGG -3'
Posted On 2014-03-14